ID: 1202140177

View in Genome Browser
Species Human (GRCh38)
Location Y:21713463-21713485
Sequence CAGTGGTGCTAGAGGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202140177_1202140189 28 Left 1202140177 Y:21713463-21713485 CCTTAATTCCTCTAGCACCACTG No data
Right 1202140189 Y:21713514-21713536 TTGGCAAGTGGCGTCCATCATGG 0: 5
1: 5
2: 11
3: 16
4: 90
1202140177_1202140191 30 Left 1202140177 Y:21713463-21713485 CCTTAATTCCTCTAGCACCACTG No data
Right 1202140191 Y:21713516-21713538 GGCAAGTGGCGTCCATCATGGGG No data
1202140177_1202140185 9 Left 1202140177 Y:21713463-21713485 CCTTAATTCCTCTAGCACCACTG No data
Right 1202140185 Y:21713495-21713517 TTCCCTGACTGAGCTGGTCTTGG 0: 3
1: 28
2: 112
3: 189
4: 364
1202140177_1202140188 16 Left 1202140177 Y:21713463-21713485 CCTTAATTCCTCTAGCACCACTG No data
Right 1202140188 Y:21713502-21713524 ACTGAGCTGGTCTTGGCAAGTGG 0: 8
1: 30
2: 49
3: 79
4: 187
1202140177_1202140190 29 Left 1202140177 Y:21713463-21713485 CCTTAATTCCTCTAGCACCACTG No data
Right 1202140190 Y:21713515-21713537 TGGCAAGTGGCGTCCATCATGGG No data
1202140177_1202140184 3 Left 1202140177 Y:21713463-21713485 CCTTAATTCCTCTAGCACCACTG No data
Right 1202140184 Y:21713489-21713511 GAGGGTTTCCCTGACTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202140177 Original CRISPR CAGTGGTGCTAGAGGAATTA AGG (reversed) Intergenic
No off target data available for this crispr