ID: 1202140272

View in Genome Browser
Species Human (GRCh38)
Location Y:21714236-21714258
Sequence CCTACAATTTAAAACTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202140267_1202140272 27 Left 1202140267 Y:21714186-21714208 CCTACTGACTGAGATGCTCTTAC 0: 4
1: 25
2: 24
3: 46
4: 194
Right 1202140272 Y:21714236-21714258 CCTACAATTTAAAACTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202140272 Original CRISPR CCTACAATTTAAAACTTGGT GGG Intergenic
No off target data available for this crispr