ID: 1202147258

View in Genome Browser
Species Human (GRCh38)
Location Y:21811914-21811936
Sequence CACCTTTTACTACTATCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202147258_1202147260 -8 Left 1202147258 Y:21811914-21811936 CCACAAGATAGTAGTAAAAGGTG No data
Right 1202147260 Y:21811929-21811951 AAAAGGTGAAGTCACTTATAGGG No data
1202147258_1202147261 -1 Left 1202147258 Y:21811914-21811936 CCACAAGATAGTAGTAAAAGGTG No data
Right 1202147261 Y:21811936-21811958 GAAGTCACTTATAGGGTGTCTGG No data
1202147258_1202147259 -9 Left 1202147258 Y:21811914-21811936 CCACAAGATAGTAGTAAAAGGTG No data
Right 1202147259 Y:21811928-21811950 TAAAAGGTGAAGTCACTTATAGG No data
1202147258_1202147262 23 Left 1202147258 Y:21811914-21811936 CCACAAGATAGTAGTAAAAGGTG No data
Right 1202147262 Y:21811960-21811982 CAACATCGAGTACCCATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202147258 Original CRISPR CACCTTTTACTACTATCTTG TGG (reversed) Intergenic
No off target data available for this crispr