ID: 1202148387

View in Genome Browser
Species Human (GRCh38)
Location Y:21823145-21823167
Sequence CCCAGGAGAGAGCAACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202148387_1202148394 18 Left 1202148387 Y:21823145-21823167 CCTTGGGGTTGCTCTCTCCTGGG No data
Right 1202148394 Y:21823186-21823208 CATGCAGCCTCAGGAGCTGCCGG No data
1202148387_1202148392 9 Left 1202148387 Y:21823145-21823167 CCTTGGGGTTGCTCTCTCCTGGG No data
Right 1202148392 Y:21823177-21823199 CTGCAGAACCATGCAGCCTCAGG No data
1202148387_1202148395 19 Left 1202148387 Y:21823145-21823167 CCTTGGGGTTGCTCTCTCCTGGG No data
Right 1202148395 Y:21823187-21823209 ATGCAGCCTCAGGAGCTGCCGGG No data
1202148387_1202148396 23 Left 1202148387 Y:21823145-21823167 CCTTGGGGTTGCTCTCTCCTGGG No data
Right 1202148396 Y:21823191-21823213 AGCCTCAGGAGCTGCCGGGCTGG No data
1202148387_1202148397 24 Left 1202148387 Y:21823145-21823167 CCTTGGGGTTGCTCTCTCCTGGG No data
Right 1202148397 Y:21823192-21823214 GCCTCAGGAGCTGCCGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202148387 Original CRISPR CCCAGGAGAGAGCAACCCCA AGG (reversed) Intergenic
No off target data available for this crispr