ID: 1202152856

View in Genome Browser
Species Human (GRCh38)
Location Y:21858906-21858928
Sequence GCAACTCCAGTGAACACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202152853_1202152856 -8 Left 1202152853 Y:21858891-21858913 CCTACCTGAGAGAGAGCAACTCC No data
Right 1202152856 Y:21858906-21858928 GCAACTCCAGTGAACACAGGTGG No data
1202152851_1202152856 20 Left 1202152851 Y:21858863-21858885 CCTGAAGCTGCGTGGTTCTGCAG No data
Right 1202152856 Y:21858906-21858928 GCAACTCCAGTGAACACAGGTGG No data
1202152848_1202152856 30 Left 1202152848 Y:21858853-21858875 CCCGGCAGATCCTGAAGCTGCGT No data
Right 1202152856 Y:21858906-21858928 GCAACTCCAGTGAACACAGGTGG No data
1202152849_1202152856 29 Left 1202152849 Y:21858854-21858876 CCGGCAGATCCTGAAGCTGCGTG No data
Right 1202152856 Y:21858906-21858928 GCAACTCCAGTGAACACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202152856 Original CRISPR GCAACTCCAGTGAACACAGG TGG Intergenic
No off target data available for this crispr