ID: 1202160598

View in Genome Browser
Species Human (GRCh38)
Location Y:21931243-21931265
Sequence GGGAATTATCTAGCAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202160592_1202160598 21 Left 1202160592 Y:21931199-21931221 CCTATCATCAAAGAATACTGCTA No data
Right 1202160598 Y:21931243-21931265 GGGAATTATCTAGCAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202160598 Original CRISPR GGGAATTATCTAGCAAACAC AGG Intergenic
No off target data available for this crispr