ID: 1202167057

View in Genome Browser
Species Human (GRCh38)
Location Y:22000839-22000861
Sequence AAAGTTGGTAATCTTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202167057_1202167065 3 Left 1202167057 Y:22000839-22000861 CCTTCTTTAAGATTACCAACTTT No data
Right 1202167065 Y:22000865-22000887 TGCTGGAGATGGAGGGAGATGGG No data
1202167057_1202167062 -4 Left 1202167057 Y:22000839-22000861 CCTTCTTTAAGATTACCAACTTT No data
Right 1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG No data
1202167057_1202167060 -8 Left 1202167057 Y:22000839-22000861 CCTTCTTTAAGATTACCAACTTT No data
Right 1202167060 Y:22000854-22000876 CCAACTTTCCTTGCTGGAGATGG No data
1202167057_1202167066 17 Left 1202167057 Y:22000839-22000861 CCTTCTTTAAGATTACCAACTTT No data
Right 1202167066 Y:22000879-22000901 GGAGATGGGAAGAGAGATGTTGG No data
1202167057_1202167064 2 Left 1202167057 Y:22000839-22000861 CCTTCTTTAAGATTACCAACTTT No data
Right 1202167064 Y:22000864-22000886 TTGCTGGAGATGGAGGGAGATGG No data
1202167057_1202167061 -5 Left 1202167057 Y:22000839-22000861 CCTTCTTTAAGATTACCAACTTT No data
Right 1202167061 Y:22000857-22000879 ACTTTCCTTGCTGGAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202167057 Original CRISPR AAAGTTGGTAATCTTAAAGA AGG (reversed) Intergenic
No off target data available for this crispr