ID: 1202167062

View in Genome Browser
Species Human (GRCh38)
Location Y:22000858-22000880
Sequence CTTTCCTTGCTGGAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202167055_1202167062 13 Left 1202167055 Y:22000822-22000844 CCACTTTCTTATTCCAGCCTTCT No data
Right 1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG No data
1202167054_1202167062 14 Left 1202167054 Y:22000821-22000843 CCCACTTTCTTATTCCAGCCTTC No data
Right 1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG No data
1202167057_1202167062 -4 Left 1202167057 Y:22000839-22000861 CCTTCTTTAAGATTACCAACTTT No data
Right 1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG No data
1202167056_1202167062 0 Left 1202167056 Y:22000835-22000857 CCAGCCTTCTTTAAGATTACCAA No data
Right 1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202167062 Original CRISPR CTTTCCTTGCTGGAGATGGA GGG Intergenic
No off target data available for this crispr