ID: 1202168777

View in Genome Browser
Species Human (GRCh38)
Location Y:22019133-22019155
Sequence TGACCCATGAATTTTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202168777_1202168784 26 Left 1202168777 Y:22019133-22019155 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202168784 Y:22019182-22019204 CAAGGTCTCATCCTCCCATTGGG No data
1202168777_1202168783 25 Left 1202168777 Y:22019133-22019155 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202168783 Y:22019181-22019203 CCAAGGTCTCATCCTCCCATTGG No data
1202168777_1202168779 8 Left 1202168777 Y:22019133-22019155 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202168779 Y:22019164-22019186 AAACCTGCTACACCAAACCAAGG No data
1202168777_1202168785 27 Left 1202168777 Y:22019133-22019155 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202168785 Y:22019183-22019205 AAGGTCTCATCCTCCCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202168777 Original CRISPR TGACCCATGAATTTTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr