ID: 1202168783

View in Genome Browser
Species Human (GRCh38)
Location Y:22019181-22019203
Sequence CCAAGGTCTCATCCTCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202168777_1202168783 25 Left 1202168777 Y:22019133-22019155 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202168783 Y:22019181-22019203 CCAAGGTCTCATCCTCCCATTGG No data
1202168780_1202168783 -9 Left 1202168780 Y:22019167-22019189 CCTGCTACACCAAACCAAGGTCT No data
Right 1202168783 Y:22019181-22019203 CCAAGGTCTCATCCTCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202168783 Original CRISPR CCAAGGTCTCATCCTCCCAT TGG Intergenic
No off target data available for this crispr