ID: 1202168785

View in Genome Browser
Species Human (GRCh38)
Location Y:22019183-22019205
Sequence AAGGTCTCATCCTCCCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202168777_1202168785 27 Left 1202168777 Y:22019133-22019155 CCTCTTTTAAAATTCATGGGTCA No data
Right 1202168785 Y:22019183-22019205 AAGGTCTCATCCTCCCATTGGGG No data
1202168780_1202168785 -7 Left 1202168780 Y:22019167-22019189 CCTGCTACACCAAACCAAGGTCT No data
Right 1202168785 Y:22019183-22019205 AAGGTCTCATCCTCCCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202168785 Original CRISPR AAGGTCTCATCCTCCCATTG GGG Intergenic
No off target data available for this crispr