ID: 1202170264

View in Genome Browser
Species Human (GRCh38)
Location Y:22036025-22036047
Sequence TCTGAAAGGCAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202170259_1202170264 11 Left 1202170259 Y:22035991-22036013 CCATGGATATAACGAGAAAAAAA No data
Right 1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG No data
1202170257_1202170264 30 Left 1202170257 Y:22035972-22035994 CCTCTAAACAACTAAAACACCAT No data
Right 1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202170264 Original CRISPR TCTGAAAGGCAGAAAGAGGA AGG Intergenic
No off target data available for this crispr