ID: 1202170264 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:22036025-22036047 |
Sequence | TCTGAAAGGCAGAAAGAGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202170259_1202170264 | 11 | Left | 1202170259 | Y:22035991-22036013 | CCATGGATATAACGAGAAAAAAA | No data | ||
Right | 1202170264 | Y:22036025-22036047 | TCTGAAAGGCAGAAAGAGGAAGG | No data | ||||
1202170257_1202170264 | 30 | Left | 1202170257 | Y:22035972-22035994 | CCTCTAAACAACTAAAACACCAT | No data | ||
Right | 1202170264 | Y:22036025-22036047 | TCTGAAAGGCAGAAAGAGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202170264 | Original CRISPR | TCTGAAAGGCAGAAAGAGGA AGG | Intergenic | ||
No off target data available for this crispr |