ID: 1202172115

View in Genome Browser
Species Human (GRCh38)
Location Y:22060800-22060822
Sequence ACTCAAGCATCTTCTAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202172115_1202172119 15 Left 1202172115 Y:22060800-22060822 CCTCCCCTAGAAGATGCTTGAGT No data
Right 1202172119 Y:22060838-22060860 CACCTAGAATTATCTAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202172115 Original CRISPR ACTCAAGCATCTTCTAGGGG AGG (reversed) Intergenic
No off target data available for this crispr