ID: 1202172117

View in Genome Browser
Species Human (GRCh38)
Location Y:22060804-22060826
Sequence GAATACTCAAGCATCTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202172117_1202172119 11 Left 1202172117 Y:22060804-22060826 CCCTAGAAGATGCTTGAGTATTC No data
Right 1202172119 Y:22060838-22060860 CACCTAGAATTATCTAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202172117 Original CRISPR GAATACTCAAGCATCTTCTA GGG (reversed) Intergenic
No off target data available for this crispr