ID: 1202172119

View in Genome Browser
Species Human (GRCh38)
Location Y:22060838-22060860
Sequence CACCTAGAATTATCTAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202172118_1202172119 10 Left 1202172118 Y:22060805-22060827 CCTAGAAGATGCTTGAGTATTCA No data
Right 1202172119 Y:22060838-22060860 CACCTAGAATTATCTAGCCCTGG No data
1202172117_1202172119 11 Left 1202172117 Y:22060804-22060826 CCCTAGAAGATGCTTGAGTATTC No data
Right 1202172119 Y:22060838-22060860 CACCTAGAATTATCTAGCCCTGG No data
1202172116_1202172119 12 Left 1202172116 Y:22060803-22060825 CCCCTAGAAGATGCTTGAGTATT No data
Right 1202172119 Y:22060838-22060860 CACCTAGAATTATCTAGCCCTGG No data
1202172115_1202172119 15 Left 1202172115 Y:22060800-22060822 CCTCCCCTAGAAGATGCTTGAGT No data
Right 1202172119 Y:22060838-22060860 CACCTAGAATTATCTAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202172119 Original CRISPR CACCTAGAATTATCTAGCCC TGG Intergenic
No off target data available for this crispr