ID: 1202174132

View in Genome Browser
Species Human (GRCh38)
Location Y:22081899-22081921
Sequence TTTGTAGGCCCCTGGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 4, 1: 1, 2: 0, 3: 11, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202174125_1202174132 0 Left 1202174125 Y:22081876-22081898 CCCAGAGGAAATCATCCTTCCCA 0: 4
1: 0
2: 5
3: 24
4: 231
Right 1202174132 Y:22081899-22081921 TTTGTAGGCCCCTGGTTTGAAGG 0: 4
1: 1
2: 0
3: 11
4: 101
1202174126_1202174132 -1 Left 1202174126 Y:22081877-22081899 CCAGAGGAAATCATCCTTCCCAT 0: 4
1: 0
2: 0
3: 19
4: 180
Right 1202174132 Y:22081899-22081921 TTTGTAGGCCCCTGGTTTGAAGG 0: 4
1: 1
2: 0
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202174132 Original CRISPR TTTGTAGGCCCCTGGTTTGA AGG Intronic
900623484 1:3597825-3597847 TTTGAAGCCACCTGGTTTGTCGG + Intronic
902542059 1:17162717-17162739 TGGGAAGGCCACTGGTTTGAGGG + Intergenic
906198362 1:43943899-43943921 TTTGTAGTCCCCTGGTTTGAGGG - Intergenic
906449261 1:45930732-45930754 TTTGCTGACCCCTGGTTTGGGGG - Intronic
912770224 1:112456911-112456933 TCTGTAGGCCACTGGCTTGTTGG - Exonic
913264581 1:117031968-117031990 TTTGAAGGCCCGTGGCTAGAAGG - Intronic
914240270 1:145848453-145848475 TTTCCAGACCCCTGGTTTGGGGG - Exonic
914249020 1:145906814-145906836 TTGGTAGTCACCTGGTTGGAAGG + Exonic
915293976 1:154907132-154907154 CTTGTAGGCCAGTGGTTTGTGGG - Intergenic
915449507 1:155994823-155994845 TTTGGAGGCCACTGGTTGGGAGG - Intronic
919201456 1:194359308-194359330 TTTGTAGGCCCTTGCTATAATGG - Intergenic
923997899 1:239517179-239517201 TTTGGAGGCCACTGGATTAAAGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1073008959 10:100345770-100345792 TTTGTTGGCCACTGGTCTCAGGG - Intergenic
1076756949 10:132577526-132577548 TTTGGTGGCCCCTGTTTTGGTGG + Intronic
1077780575 11:5324333-5324355 ATTGGAGGCTCCTGGTTTCAAGG - Intronic
1078420896 11:11211749-11211771 TTTGTAAGCCCATGGTCTGGTGG + Intergenic
1080677507 11:34441154-34441176 TTTGGAGGGCCCTGGGTGGAGGG - Intronic
1084722242 11:70914362-70914384 TTTTCTAGCCCCTGGTTTGAGGG - Intronic
1086394140 11:86396925-86396947 TTTCTAGGCCCTTGACTTGATGG - Intronic
1092215136 12:6676400-6676422 TTTGTAGTCTCCTGGGTGGATGG + Intronic
1097088885 12:56489290-56489312 TTTGTAGGTCTCTGGTAAGAGGG - Intergenic
1099856367 12:88172590-88172612 TTTGTAGGCGCTTTGTTTAATGG + Exonic
1101262540 12:103047653-103047675 TTTCTGGGCCTCGGGTTTGATGG + Intergenic
1102563881 12:113781915-113781937 TTTGTTGACCCCTGGTCTAATGG - Intergenic
1102751826 12:115301287-115301309 TTTATACGCCTCTGGGTTGATGG - Intergenic
1103559044 12:121782685-121782707 TTTGGAGGTCCCTGGGTTGAGGG - Intronic
1105606287 13:21929171-21929193 GTTGTAGGACCCAGGTTTGAAGG + Intergenic
1113056876 13:106277890-106277912 TTTGTACCCCCCTGGATAGAAGG + Intergenic
1121849284 14:97205033-97205055 TTTGATGACCCCTGGTTTGCTGG - Intergenic
1124258421 15:28164841-28164863 TTGGCAGTCTCCTGGTTTGAGGG - Intronic
1125110737 15:36029706-36029728 TTCTTAGGCTGCTGGTTTGATGG - Intergenic
1127601035 15:60537226-60537248 TTTGTGGCCCCCTTGTTTCAGGG + Intronic
1128356751 15:66933388-66933410 TTTGTAGCCAACTGGTTAGAGGG - Intergenic
1129557502 15:76528024-76528046 TTTGTTGACCCCTGATTTAAAGG - Intronic
1130244516 15:82232478-82232500 TCTGTAGGCACATGGTTTGGGGG - Intronic
1131508910 15:93038228-93038250 TCTGTAGACTCCTGGTTAGAGGG + Intronic
1131792431 15:95979832-95979854 TTTCTTGGCCTCTGGCTTGAGGG - Intergenic
1134089506 16:11384089-11384111 TTCGTAGGCCCAGGGTTTGGGGG - Intronic
1144839016 17:18174210-18174232 ATTGTAGGCCCCAGGATTGAGGG + Intronic
1149610970 17:57957442-57957464 TCTGTAGGCGGCTGGTGTGAGGG - Intergenic
1150480211 17:65503504-65503526 TTTTTAGGACCCTGCTTTGTAGG - Intergenic
1151401962 17:73861559-73861581 TTTGCAGACCCCTGCTTTAATGG - Intergenic
1152435546 17:80274120-80274142 TCTGTAGGCCTCTGCATTGAGGG + Intronic
1162067959 19:8137197-8137219 TATCTAGGCCCCAGGTTGGAGGG - Intronic
1165885572 19:39075952-39075974 TTTGCAGACCCCTGGCTTGTGGG + Intergenic
1168568711 19:57446089-57446111 GTTGTGGACCCCTGGTTTAAAGG - Intronic
926119592 2:10234864-10234886 TTGGAAGGCCCCAGGTTCGAGGG + Intergenic
928838299 2:35574994-35575016 TCTTTAGGCCCCTGGTTGGCAGG + Intergenic
934689459 2:96347162-96347184 CCTGTAGGCCACTGGTTTGACGG + Intronic
935237028 2:101148120-101148142 TTTGTAGCTCCCTCTTTTGAGGG - Intronic
936675276 2:114707540-114707562 TTTGGAGGCCATTGGTTTCATGG + Intronic
940460602 2:153958955-153958977 TTCCTAGGCCCCTGGCCTGATGG - Intronic
943792075 2:191944732-191944754 TTAGAAGGCCCCTGTTTTCAAGG + Intergenic
944231569 2:197399162-197399184 CTTGTAGGGCTCTGGTTTGCAGG - Intronic
944741427 2:202616565-202616587 TTTGTAGGCCCAGGGTTAAAAGG - Intergenic
947014155 2:225599514-225599536 TTAGTAGGACCCTGGCCTGATGG - Intronic
948081076 2:235205867-235205889 TTTGAAGACACCTGGGTTGATGG - Intergenic
948795745 2:240401316-240401338 GTTTTAAGCCACTGGTTTGAGGG + Intergenic
1173079274 20:39850335-39850357 TTTGCAGGCCTCTGGTTGGAAGG - Intergenic
1174901274 20:54503755-54503777 CTTGTAGGAACCTGGTTTGCAGG + Intronic
1178593465 21:33931708-33931730 TTTGGAGGCACCTGGTTGCAGGG + Intergenic
1181950700 22:26551579-26551601 TGTGTGGGACCCTGCTTTGATGG - Intronic
949442395 3:4096478-4096500 TTTGTAGGTCCCTGATATCAAGG + Intronic
953497617 3:43402052-43402074 TTTGTCAGCCTCTGGATTGAAGG - Intronic
956374555 3:68600554-68600576 TTTGTAGACCCCTGGACTAAAGG + Intergenic
957717434 3:83946838-83946860 TTTTAAGGCACCCGGTTTGAAGG + Intergenic
962332189 3:134488007-134488029 TTTGGGGGCCCCTGGTTTAGAGG - Intronic
964001977 3:151785877-151785899 TTTATGGGCACCTGGTTTGAGGG - Intergenic
972525551 4:39906838-39906860 TTTTTAGGCCCCTTATTAGATGG + Intronic
974169029 4:58242484-58242506 TTTGTATGCCCCCAGTTTCAAGG + Intergenic
975940552 4:79639537-79639559 TTTGTATGCCCCTGGATTGTTGG + Intergenic
979301362 4:119091420-119091442 TTTGTCAACCCCTGCTTTGATGG + Intergenic
982625965 4:157766799-157766821 TTTCTAGGCTCATGGTTAGAGGG - Intergenic
983187091 4:164712491-164712513 TTTGTAGGCTGCTGGACTGATGG + Intergenic
985335612 4:188890290-188890312 TTTGCAGGCCCCCGATTAGATGG + Intergenic
986722231 5:10567557-10567579 TCTGCAGGCTCCTGGTTTAAGGG + Intronic
996915441 5:128706924-128706946 TTTGGAGGCCAGTGGTCTGAAGG + Intronic
998915442 5:147006497-147006519 GTTGTATGCCCCTGCATTGATGG - Intronic
998993464 5:147844763-147844785 TTTGTGGGCCACTGGCTTGCTGG + Intergenic
999124237 5:149235047-149235069 TGTGTAAGCCCCTAGTTGGAAGG - Intronic
999353555 5:150902455-150902477 TTTGTTGACCCCTGCTTTCAAGG - Intronic
999449217 5:151665871-151665893 TTTGCAAGCCCCCAGTTTGAGGG - Intronic
1001910628 5:175514421-175514443 TCTTTAGGCCCCTGGTCTGAAGG - Intronic
1002993091 6:2255989-2256011 TTTGGAGGCCCCAAATTTGATGG + Intergenic
1006385124 6:33726555-33726577 CTTCTAGGACCCGGGTTTGAGGG + Intronic
1007380660 6:41488327-41488349 TTTGTGGGCTCCTGGTTGCATGG - Intergenic
1012931649 6:105323529-105323551 TTTGTAGCCCCCACGGTTGACGG - Intronic
1016430548 6:143980869-143980891 TTTGCAGACACTTGGTTTGAAGG - Intronic
1017874069 6:158509745-158509767 TTTTCAGGCCCCTGGGTAGAGGG - Exonic
1022403441 7:30063840-30063862 CTTTGAGGCCCCTGCTTTGAAGG + Intronic
1033218435 7:139511253-139511275 TTGGTAAACACCTGGTTTGAGGG - Intergenic
1035269872 7:157712971-157712993 TTTGAAGGCCCCTAGGTTCATGG + Intronic
1037739159 8:21591542-21591564 ATTCTGGGCCCCTGGTGTGATGG - Intergenic
1040567538 8:48581486-48581508 TTTGTAGGTCAGTGGTTTGAAGG + Intergenic
1041371862 8:57170098-57170120 TTTGTGAGACCCTGCTTTGATGG - Intergenic
1043204659 8:77421978-77422000 TTTGGGGACCCCTGCTTTGAAGG + Intergenic
1043473591 8:80584716-80584738 TTTGTAGGTACCTGCTTTGTAGG - Intergenic
1044058234 8:87599518-87599540 TTTTTGGGCATCTGGTTTGATGG - Intronic
1049257699 8:141622780-141622802 TTTGGAGGCCCCTGGTGCCAGGG + Intergenic
1049833940 8:144721012-144721034 TTGGTAGGCCCCTGCTTTCTTGG + Intronic
1050136056 9:2465890-2465912 TTTGTAGTCCCCTTGTATGAGGG + Intergenic
1051378521 9:16430722-16430744 TTTGTAGGCCTCTGGGTTAGCGG - Intronic
1055906947 9:81306032-81306054 TTTGTTGGCCCCTGGTCTACAGG + Intergenic
1062122478 9:134841234-134841256 TTTGCAGGCTCCTGGTTTGCGGG + Intronic
1186250480 X:7660545-7660567 CTTGTTGGCTCCTGGGTTGAAGG + Intergenic
1188776445 X:34225935-34225957 TTTGTAGGCCCCCTGGCTGAAGG - Intergenic
1193274512 X:79570277-79570299 TTTCTAGGGCCCTGGTTGGGAGG + Intergenic
1194201042 X:90952979-90953001 ATTGTAAGCCCCAGTTTTGAAGG + Intergenic
1198926190 X:141799199-141799221 TTTGTAGGCCACTGGTCTATGGG + Intergenic
1200546887 Y:4528438-4528460 ATTGTAAGCCCCAGTTTTGAAGG + Intergenic
1201782778 Y:17741731-17741753 TGTGTAGAACCCTGATTTGAAGG + Intergenic
1201818775 Y:18164257-18164279 TGTGTAGAACCCTGATTTGAAGG - Intergenic
1202174132 Y:22081899-22081921 TTTGTAGGCCCCTGGTTTGAAGG + Intronic
1202217228 Y:22504483-22504505 TTTGTAGGCCCCTGGTTTGAAGG - Intronic
1202325958 Y:23691576-23691598 TTTGTAGGCCCCTGGTTTGAAGG + Intergenic
1202544813 Y:25978478-25978500 TTTGTAGGCCCCTGGTTTGAAGG - Intergenic