ID: 1202174891

View in Genome Browser
Species Human (GRCh38)
Location Y:22088645-22088667
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 4, 1: 0, 2: 10, 3: 70, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900034826 1:398465-398487 AACCCAGGTCTGAAACAAATAGG + Intergenic
900055655 1:628343-628365 AACCCAGGTCTGAAACAAATAGG + Intergenic
905923001 1:41731494-41731516 AACTGACCTATGTAACTAACAGG + Intronic
907027329 1:51133682-51133704 AACTCAGCACTGAATCAAATGGG + Intronic
907722581 1:56985874-56985896 AACTCAGCTCTGAAAAACAGAGG - Intergenic
908733035 1:67246827-67246849 AACTCAGCTCTGGACCAAGTGGG - Intronic
909270715 1:73619913-73619935 AACTCAGCTCTGGATCAAGTGGG + Intergenic
910333495 1:86102893-86102915 AACTCAGCACTGGATCAAATGGG - Intronic
911816250 1:102356189-102356211 AACTCAGCTCTGGACCAAGAGGG + Intergenic
917060315 1:171030801-171030823 AACTCGGCTCTGGATCAAATGGG - Intronic
917290127 1:173463355-173463377 AACTCAGCTCTGGATCAAGTGGG + Intergenic
918259381 1:182781890-182781912 AGGTCAGCTGTGTAACAGACAGG + Intergenic
918673416 1:187250156-187250178 ACCTCATCTCTAAAACAAACAGG + Intergenic
920582240 1:207121523-207121545 AATTCAGCTCTGTTATATACAGG - Intronic
920751552 1:208682793-208682815 AACTCAGAGCTGTAACAGATGGG + Intergenic
921768033 1:218996729-218996751 AGCTCAGGTATGTTACAAACAGG - Intergenic
922066482 1:222148411-222148433 AACTCAGCTCTGGACCAAGTGGG + Intergenic
922257354 1:223904023-223904045 AACCCAGGTCTGAAACAAATAGG + Intergenic
922397307 1:225215422-225215444 AACTCAGCTCTGCACCAAGCAGG - Intronic
922397668 1:225218785-225218807 AACTCAGCTCTGGACCAAGTAGG + Intronic
922538394 1:226400625-226400647 AACACAGCACTGTCACCAACAGG + Intronic
924037042 1:239948398-239948420 AATTTACCTGTGTAACAAACCGG + Intergenic
924298766 1:242615230-242615252 AACTCAGCTCTGCACCAAGCGGG + Intergenic
924455727 1:244217563-244217585 ATCTCAGGCCTGTAATAAACAGG + Intergenic
1064740255 10:18425848-18425870 AAAATAGCTCTGGAACAAACAGG - Intronic
1066553776 10:36588440-36588462 AACTGACCTCTGAAACAACCTGG - Intergenic
1067468647 10:46520584-46520606 CACACAGTTCTGTAAGAAACGGG - Intergenic
1067579299 10:47431340-47431362 TACTCAGCTCTGGACCAAGCGGG - Intergenic
1068916754 10:62441203-62441225 CTCTCAGCTCTGCAACATACTGG - Intronic
1069093220 10:64227516-64227538 AACTCAGCTCTGGACCAAGCTGG - Intergenic
1070980218 10:80639301-80639323 AACTCAGCTCTGCACCAAGCAGG - Intronic
1071127663 10:82354058-82354080 CACTCAGCCCTGTCTCAAACAGG + Intronic
1071340187 10:84639143-84639165 AACTCAGCTCTGGACCAAGCGGG + Intergenic
1072375454 10:94811396-94811418 AACTAAGCTCTGGACCAAGCGGG - Intronic
1072389333 10:94967202-94967224 AACTAAGCTCTGGACCAAGCGGG - Intronic
1075402766 10:122172875-122172897 AACTCAGCGCTCTCACACACAGG - Intronic
1075937329 10:126353603-126353625 AACTCAGCTCTTTAATAAACAGG - Intronic
1076565357 10:131394814-131394836 AAGTCAGCTCTTAAACAAATAGG - Intergenic
1077737116 11:4803320-4803342 AAGTCAGCTCTGTAAATAACTGG - Intronic
1078307814 11:10208095-10208117 ATCTTAGCTCTGTCACTAACTGG + Intronic
1079326434 11:19496633-19496655 GACTAACCTGTGTAACAAACAGG - Intronic
1080138164 11:28882918-28882940 AATTCAGCTCTGGACCAAGCGGG - Intergenic
1080683081 11:34494055-34494077 AACTCAGCTGTTTGACAAGCTGG + Intronic
1081096944 11:38948071-38948093 CACTCATCTATATAACAAACTGG + Intergenic
1081919088 11:46756078-46756100 AACTCAGCTTTCTCACATACTGG + Intronic
1082556067 11:54564734-54564756 AACTCAGCTCTGCAACAAGTGGG - Intergenic
1082886717 11:58091659-58091681 AACTCAGCTCTGCACCAAGAGGG - Intronic
1084410172 11:69002300-69002322 AAGTCGGCTTTGTAACAACCAGG + Intergenic
1085579012 11:77634134-77634156 AACTAAGCTCTGAAATAAGCCGG + Intronic
1086827189 11:91513597-91513619 AACTCACCTTTGTAACTAAGAGG + Intergenic
1087257146 11:95968817-95968839 AACTCTGCTGTGTCACAAAGGGG - Intergenic
1088049946 11:105499943-105499965 TACTTAGCTTTGTAAGAAACTGG + Intergenic
1088972788 11:114788230-114788252 AGCTCAGCTCTGCCACAAAAGGG - Intergenic
1092325940 12:7531114-7531136 AACTCAGCTCTGCACCAAGCAGG + Intergenic
1092519217 12:9249943-9249965 AACTCAGCTCTGGATCAAGTGGG + Intergenic
1094304225 12:28999533-28999555 AACTCAGTCATGGAACAAACTGG - Intergenic
1095771149 12:45958939-45958961 AACACTGGTCTGTAAGAAACTGG - Intronic
1095931188 12:47626764-47626786 AACTCAGCTCTGGACCAAGCAGG + Intergenic
1096001007 12:48130528-48130550 AACACAGCAATGTAACTAACTGG - Intronic
1098246320 12:68522285-68522307 ATCACAGCTCTGTAAGGAACAGG + Intergenic
1098680480 12:73347879-73347901 AACTCAACTCTGGACCAAGCAGG - Intergenic
1099362391 12:81720778-81720800 AAGTCAGCTCAGTCACAAAAAGG - Intronic
1100031542 12:90198496-90198518 AACCCAGCTCTTTCATAAACCGG + Intergenic
1101019617 12:100540162-100540184 AACTCAGCACTGCGACACACAGG - Intronic
1102741128 12:115208305-115208327 ACCTCAGCTCTGTAACCCAAGGG + Intergenic
1103032309 12:117626720-117626742 AACTCAGATCTGCAACAAGCAGG - Intronic
1103271063 12:119674162-119674184 TACTCAGCTCTGCCACACACGGG - Intronic
1104333345 12:127868342-127868364 AACTCAGCTCTGCACCAAGCGGG + Intergenic
1104556354 12:129803165-129803187 AACTCAGCTCTGCACCAAGCGGG + Intronic
1106819638 13:33450590-33450612 AAGACAGCTCTATAACAAAAAGG + Intergenic
1107289561 13:38837455-38837477 AACTCAGCTATGGACCAAGCAGG - Intronic
1108075629 13:46676339-46676361 AACACAGGTATGTAACTAACCGG - Intronic
1108998560 13:56765772-56765794 AACTCAGCTCTGGACCAAGCAGG + Intergenic
1109921726 13:69072598-69072620 AACTCCACTCCGTAACAAAAAGG - Intergenic
1112584000 13:100700584-100700606 AACTCAGCTCTGCACCAAGTGGG + Intergenic
1114452120 14:22834158-22834180 AACTCGTCTCTGAAACAGACAGG - Exonic
1116155732 14:41202549-41202571 AACTCAGCCCAGTAAAAAGCAGG + Intergenic
1116408161 14:44591708-44591730 AACTGAGTTCTGTTACAAACTGG - Intergenic
1116560662 14:46375093-46375115 AACTCAGCTCTGGATCAAGTGGG - Intergenic
1116696974 14:48189573-48189595 AACTCAGCTCTGCACCAAGCAGG + Intergenic
1117340951 14:54790639-54790661 GACTCATCCATGTAACAAACAGG - Exonic
1117710984 14:58528330-58528352 AACTCAGCTGTGGACCAAGCAGG + Intronic
1117892888 14:60445688-60445710 AACTCAGCTCTGCACCAAATGGG + Intronic
1118160867 14:63288923-63288945 CACTCAGCTCTGCAAGAAGCTGG - Intronic
1119435865 14:74597477-74597499 CACTCAGCTCTTTGATAAACAGG + Intronic
1119772118 14:77226643-77226665 TACTCATCTCTGCAACAAACTGG - Intronic
1119936681 14:78598422-78598444 AAGTCAGATCTGTAACACAGAGG + Intronic
1120375302 14:83696941-83696963 GACCTAGCTCTGTAACAAAATGG - Intergenic
1121174361 14:91879630-91879652 AGCTCTGCTCTGCCACAAACAGG + Intronic
1121921605 14:97887298-97887320 AACTCAGCACTGGATCAAAGAGG + Intergenic
1122163606 14:99804515-99804537 ACCCCAGCTCTGAAACACACTGG - Intronic
1122207555 14:100155578-100155600 AACCCATCTCTGTAACGTACGGG - Intronic
1123225126 15:17016206-17016228 AACTCAGCTCTGCACCAAGCGGG + Intergenic
1124244427 15:28057511-28057533 GCATCAGCTCTGTAACAGACAGG + Intronic
1127400500 15:58580576-58580598 AACTCAGCTGTGAAACCATCTGG + Intergenic
1129245245 15:74275216-74275238 ACCCCAGCTCTGTAACTTACTGG + Intronic
1129811492 15:78514352-78514374 AATTCAGCTCTTTAAGCAACAGG + Intronic
1130631771 15:85576565-85576587 AAATCAGCTCTGAAATAAACTGG - Intronic
1132168934 15:99627564-99627586 AACTCAGTAGTCTAACAAACTGG + Intronic
1133976433 16:10602435-10602457 ATCTCAGCTCTGTAACTAGATGG + Intergenic
1134204982 16:12229839-12229861 AGCTCAGCTCTGTCTCATACTGG + Intronic
1134464855 16:14466436-14466458 AACTCAGCTCTGTTACGATTTGG + Intronic
1134611934 16:15615979-15616001 AACTCTGCAATGTAACAATCTGG + Exonic
1135881582 16:26262886-26262908 AGCTTACCTATGTAACAAACAGG + Intergenic
1137356391 16:47769543-47769565 AACTCAGCTCTGCACCAAGCAGG + Intergenic
1137356645 16:47772682-47772704 AACTCAGCTCTGGACCAAGAAGG - Intergenic
1139457149 16:67089844-67089866 TACTGAGCTCTGCAACAACCTGG - Intronic
1142586517 17:978378-978400 AACTCAACTCGGCAGCAAACTGG + Intronic
1142939423 17:3370128-3370150 AACTCAGCTGTGAAACCATCTGG + Intergenic
1143006595 17:3839832-3839854 ATCTCAGCTCTGCCACTAACTGG + Intronic
1144325617 17:14176800-14176822 AAGGGAGCTCAGTAACAAACAGG - Intronic
1144474494 17:15573689-15573711 AAGGGAGCTCAGTAACAAACAGG - Exonic
1144730977 17:17526167-17526189 AGCTGAGCTCTGGAACACACAGG + Intronic
1145014072 17:19385553-19385575 AACCCAGTCCTTTAACAAACTGG - Intronic
1147651661 17:42065867-42065889 ATCTCAGCTCTGTCACTCACTGG + Intergenic
1147990361 17:44328934-44328956 AATTCAGCCTTGTAATAAACTGG - Intergenic
1150247710 17:63688796-63688818 AACTCAGCTTTATGACAAAGGGG + Exonic
1154224148 18:12486573-12486595 ACCTCAGCTCTGCCACTAACTGG + Intronic
1155101870 18:22618839-22618861 AACTCAGCTCTACACCAAGCAGG + Intergenic
1155393254 18:25359761-25359783 CACTCAGTACTGTAATAAACAGG - Intergenic
1155476647 18:26242100-26242122 AACTCAGCTCTGCACCAAGCAGG - Intronic
1155568275 18:27161626-27161648 AACTCAGCTCTGCACCAAGTGGG - Intronic
1156207065 18:34897394-34897416 AACTCAGCTCTGCACCAAGCAGG + Intergenic
1156937818 18:42732425-42732447 ATTTCAGCCCTGTAAAAAACTGG - Intergenic
1157020851 18:43780037-43780059 AACTCAACTCTAAAACAGACAGG + Intergenic
1163093524 19:15038182-15038204 AACTCAGCTCTGTGAAGAAGGGG - Intergenic
1166368615 19:42289750-42289772 ATCTCAGCTCTGCTCCAAACCGG - Intronic
1166908169 19:46129875-46129897 AACTCAGCACTGGATCAAATGGG - Intergenic
1167973833 19:53207839-53207861 AACTCAACTCTGGACCAAGCAGG - Intergenic
1168701864 19:58444982-58445004 AACTCTCCTCTGTATCAAAATGG + Intergenic
925528331 2:4830035-4830057 AACTTACCTATATAACAAACTGG - Intergenic
926545699 2:14236516-14236538 ATCACTGCTCTGAAACAAACAGG + Intergenic
927284136 2:21338539-21338561 AACTCAGCTCTGCACCAAGCGGG + Intergenic
928243210 2:29604656-29604678 AACTCAACTTTGGCACAAACAGG - Intronic
930557365 2:52915265-52915287 AAATAAGGTCTGTAACAGACTGG - Intergenic
931109018 2:59090259-59090281 AACTCAGCTCTGCACCAAGCAGG - Intergenic
932553652 2:72798409-72798431 AACTCTGATCTGTAACATACTGG + Intronic
933324490 2:80817771-80817793 AACTCAGCTCTGGATCAAGTGGG + Intergenic
933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG + Intergenic
935514231 2:104016514-104016536 AAATCAGCTCAGTCACAAACCGG - Intergenic
935983115 2:108646120-108646142 AACTTAGCTCTGGACCAAGCGGG + Intronic
937802244 2:126093707-126093729 AACTCAGCTCTGAAACCATTGGG - Intergenic
937803105 2:126103577-126103599 AACTCAGCTCTGCACCAAGCGGG + Intergenic
938788304 2:134654062-134654084 AACTCAGCTCTGCACCAAGTGGG - Intronic
940370817 2:152898495-152898517 AACTCAGCTCTCAACCAAGCAGG + Intergenic
940540813 2:155014137-155014159 AAATCAGCTCTATAATAATCTGG - Intergenic
940557127 2:155243392-155243414 ACCTCTGCTCTGTAAGAAATTGG - Intergenic
940920815 2:159304528-159304550 AACTCAGTTCTGGATCAAGCAGG + Intergenic
941339625 2:164290655-164290677 AACTCAGCTCTGGACCAAGAGGG + Intergenic
942848286 2:180452968-180452990 AACTCAGCTCTGTATTACCCAGG - Intergenic
943158760 2:184219084-184219106 AACTCAGCTCTGAATCAAGTGGG - Intergenic
943262625 2:185685866-185685888 AACTCAGCTCTGGACCAAACGGG - Intergenic
944536257 2:200713411-200713433 TGCCCAGCTCTGTAACAACCTGG - Intergenic
944863040 2:203833719-203833741 ACTGCAGCTCTGAAACAAACGGG - Intergenic
946649049 2:221871359-221871381 AACTCAGCTCTGGATCAAGCAGG + Intergenic
946892391 2:224291316-224291338 CACTCAGCTCTTTAAGCAACAGG + Intergenic
946917209 2:224536060-224536082 ATCCCAGCTCCCTAACAAACTGG + Intronic
947525334 2:230873842-230873864 AACTCAGATCTGGCAGAAACTGG + Intronic
947704845 2:232266090-232266112 AACTGAACTTTGCAACAAACTGG - Intronic
1169334351 20:4743120-4743142 AACTCCGCTCTGTTACCAAGTGG - Intergenic
1169771590 20:9207220-9207242 ACCTCAGCCATGTAACCAACAGG + Intronic
1170265717 20:14465050-14465072 AACTCAGCTCTGCACCAAGAGGG - Intronic
1172906966 20:38377642-38377664 AACACATCTCTGTCACACACAGG - Intergenic
1173581163 20:44147823-44147845 ATCTCAGCTCTGTCACTTACTGG + Intronic
1176915800 21:14623752-14623774 AACTCAGCTCTGCACCAAGCGGG + Intronic
1177129915 21:17243095-17243117 AACTCAGCTCTGGACCAAGTGGG + Intergenic
1178163191 21:29942011-29942033 AAGTCAGCTTTTGAACAAACTGG + Intergenic
1179379837 21:40888287-40888309 CACGAAGCTCTGAAACAAACAGG + Intergenic
1179502153 21:41816595-41816617 AACACAGCTCTGTAGTAAGCTGG + Intronic
1180422190 22:12876027-12876049 AACTCAGCTCTGCACCAAGCAGG + Intergenic
949427893 3:3939378-3939400 AAATCAGCTCTGCAACAAGCAGG - Intronic
949845163 3:8362317-8362339 AACTCAGCTCCCAACCAAACTGG + Intergenic
950330538 3:12152687-12152709 ATTTCAGCTCTGTAAGAAAAAGG + Intronic
951346967 3:21558666-21558688 AACTCAGCTCTGGGCCAAGCGGG - Intronic
952392276 3:32890806-32890828 CACTCACCTCTGCACCAAACAGG - Exonic
953790476 3:45943502-45943524 AGCTCATCTCTGGAACAAACTGG + Intronic
954898935 3:54002421-54002443 AACCCAGCTCTGGCACACACTGG + Intergenic
955168863 3:56543267-56543289 AACTCAGCTCTGCACCAAGCGGG - Intergenic
955721461 3:61885876-61885898 ACCCCAGCTCTGTATTAAACAGG - Intronic
956000692 3:64726936-64726958 AACTCAGCCCTGCAAGAAATAGG - Intergenic
956477161 3:69634869-69634891 AACTCAGCTCTGCACCAAGTGGG - Intergenic
956641035 3:71415823-71415845 ACCTCAGCCCTGTAACATAAAGG + Intronic
958072995 3:88638874-88638896 AACTCAGCTCTGGATCAAGTGGG - Intergenic
958255238 3:91318146-91318168 AACTCAGCTCTGCACCAAGTGGG - Intergenic
958780216 3:98532142-98532164 AACACAGCTGTGTAAAAGACTGG - Exonic
959061631 3:101621568-101621590 AATTTATCTGTGTAACAAACCGG - Intergenic
959723717 3:109520974-109520996 AACTCAGCTCTGCACCAAGCAGG - Intergenic
960249864 3:115439961-115439983 AACTCAGCTCCGCATCAGACAGG + Intergenic
961407397 3:126690871-126690893 AACTATGCTCTGGAACAAATGGG + Intergenic
961500212 3:127327013-127327035 AAGTCAGATCTGAAAGAAACTGG + Intergenic
962634574 3:137317754-137317776 AACTCAGCTCTGCAACAAGCAGG - Intergenic
962656583 3:137550935-137550957 AACTCAGCTTTGAAACTATCTGG + Intergenic
963455739 3:145544336-145544358 AATTCAGCTATGTAACCATCTGG + Intergenic
963913673 3:150838243-150838265 AACTCAGCACTGGATCAAATGGG - Intergenic
964832018 3:160894611-160894633 AACTCAGCTCTGCCACTAACTGG - Intronic
965010319 3:163079657-163079679 AACTCGGCTCTGGACCAAGCAGG - Intergenic
965112578 3:164447055-164447077 AACTCAGCTCTGGATCAAGTGGG - Intergenic
965515378 3:169616078-169616100 AGCTCAGCTCTGTGGCATACTGG + Intronic
968272278 3:197412534-197412556 AACTCAGCTCTGCACCAAGCGGG + Intergenic
968683261 4:1936737-1936759 AACTCAGATCAGTGAAAAACAGG - Intronic
970976006 4:22043749-22043771 CACTCAGCTCTCTTGCAAACAGG - Intergenic
971086103 4:23276984-23277006 AACTTAGCTCTGGCACAAAAAGG - Intergenic
972269827 4:37500633-37500655 AACTCAGCACTGGATCAAATGGG - Intronic
972994631 4:44864731-44864753 AATACACCTTTGTAACAAACTGG - Intergenic
974177226 4:58339702-58339724 AACTCAGCTCTGCACCAAGCGGG + Intergenic
974218206 4:58928831-58928853 AACTCAGCTCTGCACCAAGAGGG + Intergenic
974666181 4:64964747-64964769 AATTTACCTGTGTAACAAACTGG - Intergenic
975313371 4:72927158-72927180 ACCTAAGCTCTGCAACAAAAGGG - Intergenic
975764949 4:77657334-77657356 AACTCAGCCCTGGACCAAGCAGG + Intergenic
976639214 4:87319976-87319998 AACTCTTCTCTGTGACAAAGAGG + Intronic
976760309 4:88541568-88541590 AACTCAGCTCTGCAACAAGCAGG + Intronic
977004023 4:91542817-91542839 AACTCAGCTCTGCACAAAGCAGG - Intronic
979291207 4:118980947-118980969 GAATCAGCTCTGCCACAAACTGG - Intronic
980868560 4:138583303-138583325 AACTCAGCTGTGAAACCATCTGG + Intergenic
982367732 4:154598564-154598586 AACACTGCTCTGTAGCAACCTGG - Intergenic
982579593 4:157160847-157160869 AACTCAGCTCTGCACCAAGTGGG - Intronic
982620190 4:157694109-157694131 AACTCAGCTCTGCACCAAGCAGG + Intergenic
983193981 4:164784315-164784337 AACTGAACCCTGAAACAAACAGG + Intergenic
985854745 5:2416139-2416161 AACTCAGCTCCTTTATAAACAGG + Intergenic
989517445 5:42359770-42359792 AAATCTGCTCTGTCACAATCTGG - Intergenic
990196477 5:53322618-53322640 CACTCAGCTCTGGAGCCAACTGG + Intergenic
990870231 5:60423170-60423192 AACTCAGCTCCGCAACAAGCGGG + Intronic
992055774 5:72987839-72987861 AAACCAGCTCTCTAACAAAAAGG - Intronic
992183089 5:74217048-74217070 AACTCAGCTCTGCACCAAGCAGG + Intergenic
992672624 5:79075352-79075374 AACTAAGCTGTGTAAAAAAGAGG - Intronic
992756730 5:79913594-79913616 AACTCAGCTCTGGACCAAGTGGG + Intergenic
993085340 5:83357020-83357042 AACTCAGATTTGTAAAATACAGG + Intergenic
993768777 5:91897143-91897165 TACTCAATTCTGTAAAAAACTGG - Intergenic
993984906 5:94585666-94585688 AACTCAGCTCTGGACCAACCGGG + Intronic
994001433 5:94785688-94785710 ACCTCAACTTTGTAACAAAAAGG + Intronic
994299041 5:98124018-98124040 AACTCAGCTCTGGATCAAGTGGG + Intergenic
994414436 5:99450167-99450189 CACTTAGTTTTGTAACAAACAGG + Intergenic
995670843 5:114600646-114600668 AACTCAGCTCTGCAACAAGCAGG + Intergenic
996923666 5:128798072-128798094 AACTCAACTCTCTCACACACAGG + Intronic
997380584 5:133433764-133433786 AAGTCAGCTCTGTAAAGAGCTGG + Intronic
997600095 5:135133228-135133250 CACTCAGCTCTGTGACAGCCAGG + Intronic
997793062 5:136779930-136779952 GCCTCAGCTCTGTAACCACCAGG + Intergenic
997996943 5:138594469-138594491 ACCTCAGGTCTGTGAGAAACAGG + Intergenic
998802103 5:145879678-145879700 AACTCAGCTCTGCACCAAGCGGG + Intergenic
999789864 5:154929282-154929304 AACTCAGCTGTGTTACTAGCTGG - Intronic
999861985 5:155657982-155658004 AACTCAGCTCTGCACCAAGCAGG + Intergenic
999938878 5:156518464-156518486 AACTCAGCTCTGGATCAAGTGGG + Intronic
1002738993 5:181420406-181420428 AACCCAGGTCTGAAACAAATAGG - Intergenic
1002841816 6:912992-913014 AACTCAGTTCAGTCAGAAACTGG - Intergenic
1003849121 6:10203821-10203843 AACTCGGCTCTGTAACCAGAAGG - Intronic
1007978107 6:46122056-46122078 AATTCAGCTCTGCACCAAGCAGG + Intergenic
1008089191 6:47276170-47276192 AACTCATCTCTTTGCCAAACTGG - Intronic
1008122999 6:47639141-47639163 AACTCAGTTCTGCACCAAGCAGG - Intergenic
1008483265 6:52008270-52008292 AACTCATCTCTGAAATGAACTGG + Intronic
1008785364 6:55160959-55160981 AACTCAGCTCTGGACCAAGCAGG + Intronic
1009000110 6:57703025-57703047 AACTCAGCTCTGCACCAAGTGGG + Intergenic
1009190092 6:60620013-60620035 AACTCAGCTCTACACCAAGCGGG - Intergenic
1010093256 6:72008950-72008972 AACTCAGCTCTGCACCAAGCGGG + Intronic
1010477196 6:76302521-76302543 AACTCAGCTATGGAACCAAGTGG - Intergenic
1010747494 6:79580268-79580290 AACTCAGCTCTGCAACAAGCAGG + Intergenic
1010822424 6:80431335-80431357 GACTCAGCTCTGGACCAAGCAGG - Intergenic
1011204104 6:84872963-84872985 AAATTGGCTCTGTAACAAATAGG + Intergenic
1012757443 6:103249749-103249771 AACTCAGCTCTGCAACAAGTGGG + Intergenic
1012799294 6:103804469-103804491 AACTCAGCTCTGGACCAAGTGGG + Intergenic
1013142206 6:107348468-107348490 AACTCAGGAGTGAAACAAACAGG + Intronic
1013372188 6:109480762-109480784 ATCCCAGCTCTGTCACTAACGGG + Intronic
1014829588 6:126086647-126086669 AACTTAACTCTGTAACAACATGG - Intergenic
1014906685 6:127038637-127038659 AACTCAGCCCAGTACCAAATGGG + Intergenic
1015430099 6:133121171-133121193 AACTCAGCTCTGCACCAAGCAGG - Intergenic
1015679106 6:135783793-135783815 AACTCAGCACTGGATCAAATGGG + Intergenic
1016423496 6:143910480-143910502 AACTCAGCTCTGGATCAAGTGGG - Intronic
1017113311 6:150952957-150952979 AATTATGCTCTGTAACAAAATGG - Intronic
1017888198 6:158617993-158618015 AACTCAGCTCTGCACCAAGCAGG - Intronic
1018402023 6:163432706-163432728 GACTCAGATCTATAACAAAGTGG - Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1019244102 6:170695958-170695980 AACCCAGGTCTGAAACAAATAGG - Intergenic
1019367951 7:644851-644873 GACTCAGCTCTGCAGCACACGGG - Intronic
1021278284 7:18683761-18683783 AACTCTGCTTGTTAACAAACTGG + Intronic
1024795088 7:53010516-53010538 AACTCAGCTCTGGATCAAGTGGG - Intergenic
1025148960 7:56531304-56531326 TATTTAGCTCTGTAAGAAACTGG - Intergenic
1026474964 7:70727329-70727351 AACCCAGCCCTGTGGCAAACAGG - Intronic
1029041712 7:97582661-97582683 AACTCAGCTCTGGATCAAATGGG + Intergenic
1030395379 7:108980060-108980082 AACTCAGCTCTGAACGAAGCAGG - Intergenic
1031061185 7:117053395-117053417 AAGTCAGCTCTGTTACTCACGGG + Intronic
1031886097 7:127247436-127247458 CATTCAGCTCTTTAACAAAAAGG + Intronic
1034143638 7:148848613-148848635 TACTCAGAGCTGTAACAAAGGGG + Intronic
1035504023 8:112202-112224 AACCCAGGTCTGAAACAAATAGG + Intergenic
1035913453 8:3594470-3594492 ACCTCAGCTTTGTTACCAACAGG - Intronic
1035954286 8:4058918-4058940 AACTCAGCTCTGCACCAAGCGGG + Intronic
1036803753 8:11812577-11812599 AACTTATCTTTGTAACAACCTGG - Intronic
1037615523 8:20515615-20515637 AACTCAACTCTGTCACTAACTGG - Intergenic
1038817898 8:30924847-30924869 AATTCAAATCTGTAAAAAACAGG - Intergenic
1039658444 8:39435678-39435700 AACTCAGCTCTGAATCAAGTGGG + Intergenic
1039676516 8:39674138-39674160 AACTCAGCTCTGCAACAAGCAGG - Intronic
1040050345 8:43007833-43007855 AGCTTCTCTCTGTAACAAACAGG - Exonic
1040390378 8:46944772-46944794 AACTCAGCTCTGCACCAAGCAGG + Intergenic
1040899057 8:52399041-52399063 AATTCAGCTCTGAAGCCAACTGG + Intronic
1041972349 8:63758577-63758599 AACTCAGCTCTGGAACAAGTGGG - Intergenic
1042638362 8:70904134-70904156 AACTCAGCTCTGCACCAAGTGGG - Intergenic
1045877783 8:107002352-107002374 AACTCAGCTCTGCACCAAGTGGG + Intergenic
1046739935 8:117817101-117817123 CAAGCAGCTCTCTAACAAACAGG + Intronic
1048132467 8:131712971-131712993 AAATCAGCTCTGCAACAATATGG + Intergenic
1048836725 8:138525692-138525714 AACAAAGCTCTGTACCAAACTGG - Intergenic
1052173124 9:25426281-25426303 AACTCAGTTCTTTAACTCACAGG + Intergenic
1053508312 9:38665666-38665688 AACTCAGCTTTCTAAGCAACTGG + Intergenic
1054719502 9:68590701-68590723 AACTCAGCTCTGGACCAAGCAGG - Intergenic
1054980475 9:71200388-71200410 AACTCAGCTCTGCACCAAGCGGG - Intronic
1055498485 9:76879850-76879872 TACTCAGTTCTGTAAGAAAGAGG + Intronic
1055594948 9:77856444-77856466 AACTCAACTTTTTAATAAACTGG + Intronic
1056272915 9:84964504-84964526 AACTCAGCTCGGTATTCAACGGG + Intronic
1057018077 9:91672065-91672087 AACTCAGCTCTGGATCAAGTTGG - Intronic
1057516050 9:95722292-95722314 TATTCATCACTGTAACAAACAGG + Intergenic
1058199801 9:102025756-102025778 AACTCAGCTCTGGAACAAGAAGG - Intergenic
1059509756 9:114833945-114833967 AACTCAGCTCTGGATCAAGTGGG - Intergenic
1061728223 9:132593338-132593360 AACCCAGCTGTGTGAAAAACAGG - Exonic
1061763022 9:132863453-132863475 AACTCACCTCGGTACCCAACAGG + Intronic
1203717385 Un_KI270742v1:166581-166603 AACTCAGCTCTGCACCAAGCAGG - Intergenic
1203604292 Un_KI270748v1:45182-45204 AACCCAGGTCTGAAACAAATAGG - Intergenic
1186743355 X:12540716-12540738 AACTCAGCTCTGCACCAAGTGGG + Intronic
1187851405 X:23594903-23594925 AACTCAGCACCGTAGCAACCTGG - Intergenic
1188946727 X:36314454-36314476 AACTCAGAGCTGTAACCAATCGG - Intronic
1189026465 X:37400108-37400130 AACTCAGCTCTGCACCAAGTGGG + Intronic
1189711799 X:43820683-43820705 AACTCAGGCATGCAACAAACTGG + Intronic
1189895836 X:45655509-45655531 AACTCAGCACTGGATCAAATGGG - Intergenic
1190341115 X:49297030-49297052 AACTCAGCTCTGGACCAAGCGGG - Intronic
1191099387 X:56709257-56709279 AACTCAGCTCTGGATCAAGTGGG - Intergenic
1191223986 X:58020744-58020766 AACTCAGCTCTGAATCCATCTGG - Intergenic
1191594370 X:62925701-62925723 AACTCAACTCTGTATCAAGTGGG + Intergenic
1191772212 X:64773542-64773564 AACTCAGCTCTGGACCAAGCAGG - Intergenic
1191823875 X:65342282-65342304 AACTCAGCACTGGATCAAATGGG + Intergenic
1191890819 X:65938401-65938423 AACTCAGCTCTGCACCAAGCAGG + Intergenic
1192393892 X:70758250-70758272 AACTCAGCTCTGGACCAAACAGG + Intronic
1192843849 X:74884772-74884794 AACTCAGCTCTGCACCAAGCGGG + Intronic
1192974105 X:76265263-76265285 AACTCAGCTCTGGACCAAGCAGG - Intergenic
1192976397 X:76290483-76290505 AACTCAGCTCTGCACCAAGTGGG + Intergenic
1193019702 X:76778579-76778601 AACTCAGCTCTGGACCAAGCAGG - Intergenic
1193601508 X:83512282-83512304 AGCTCAGCTCTGAAATACACTGG + Intergenic
1193992043 X:88320386-88320408 AACTCAGCTCTGCACCAAGCGGG - Intergenic
1194104296 X:89749780-89749802 AACTCAGCTGTGTATCCATCTGG + Intergenic
1194254616 X:91621387-91621409 AACTCAGCTCTGGACCAAGCAGG - Intergenic
1194406010 X:93496422-93496444 AACTCAGCTCTGGATCAAGTGGG + Intergenic
1194608241 X:96007691-96007713 AACTCAGCTCTGTATCAAGTGGG + Intergenic
1194900239 X:99500519-99500541 AAGTCAGCACTGTATCAAACGGG + Intergenic
1195367998 X:104144937-104144959 AACTCAGCTCTGGACCAAGCAGG + Intronic
1197395813 X:125925565-125925587 AATTCAGCTCTGGATCAAATGGG - Intergenic
1197542164 X:127777541-127777563 GTCTTAGCTCTGTAATAAACAGG + Intergenic
1199502197 X:148519218-148519240 AACTGACTTCTGTAACAAGCAGG - Intronic
1199544846 X:148997226-148997248 AACTAAGCTCAGTAACAAGAAGG + Exonic
1199819206 X:151427977-151427999 ACCTCAGCTCTGCCACATACTGG - Intergenic
1200456255 Y:3397559-3397581 AACTCAGCTGTGTATCCATCTGG + Intergenic
1200573399 Y:4860979-4861001 AACTCAGCTCTGGACCAAGCAGG - Intergenic
1200778554 Y:7193503-7193525 AACTCAGCTCTGCACCAAGTGGG - Intergenic
1201520755 Y:14870930-14870952 AACCCAGCTCAGTAACAGAAAGG - Intergenic
1201783562 Y:17748364-17748386 AACTCAGCTCAGCAACAAACAGG + Intergenic
1201817991 Y:18157623-18157645 AACTCAGCTCAGCAACAAACAGG - Intergenic
1202174891 Y:22088645-22088667 AACTCAGCTCTGTAACAAACTGG + Intronic
1202216471 Y:22497737-22497759 AACTCAGCTCTGTAACAAACTGG - Intronic
1202326717 Y:23698332-23698354 AACTCAGCTCTGTAACAAACTGG + Intergenic
1202343375 Y:23892976-23892998 AATTCAGCTGTGAATCAAACTGG - Intergenic
1202386341 Y:24330228-24330250 AACCCAGGTCTGAAACAAATAGG - Intergenic
1202484445 Y:25339900-25339922 AACCCAGGTCTGAAACAAATAGG + Intergenic
1202527393 Y:25777109-25777131 AATTCAGCTGTGAATCAAACTGG + Intergenic
1202544053 Y:25971721-25971743 AACTCAGCTCTGTAACAAACCGG - Intergenic