ID: 1202175645

View in Genome Browser
Species Human (GRCh38)
Location Y:22096658-22096680
Sequence AAGTATCTGCATCTTGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202175645_1202175649 30 Left 1202175645 Y:22096658-22096680 CCTTTTCCAAGATGCAGATACTT No data
Right 1202175649 Y:22096711-22096733 TGCTAGACAGAGCTCACAATCGG No data
1202175645_1202175648 -8 Left 1202175645 Y:22096658-22096680 CCTTTTCCAAGATGCAGATACTT No data
Right 1202175648 Y:22096673-22096695 AGATACTTCTTGCTAGGCAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202175645 Original CRISPR AAGTATCTGCATCTTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr