ID: 1202177825

View in Genome Browser
Species Human (GRCh38)
Location Y:22113876-22113898
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202177815_1202177825 28 Left 1202177815 Y:22113825-22113847 CCTGGCAGCTCTAGAGGCTGCAT No data
Right 1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG No data
1202177820_1202177825 -10 Left 1202177820 Y:22113863-22113885 CCTACCTGGGAGACTGCAATCCT No data
Right 1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG No data
1202177819_1202177825 -9 Left 1202177819 Y:22113862-22113884 CCCTACCTGGGAGACTGCAATCC No data
Right 1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202177825 Original CRISPR CTGCAATCCTGGGGAAAAAA TGG Intergenic
No off target data available for this crispr