ID: 1202178829

View in Genome Browser
Species Human (GRCh38)
Location Y:22121997-22122019
Sequence TTTTGTGGAGGGCCCCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202178829_1202178836 -2 Left 1202178829 Y:22121997-22122019 CCTTGCTGGGGCCCTCCACAAAA No data
Right 1202178836 Y:22122018-22122040 AAGGCAGGAACCATGACAAAGGG No data
1202178829_1202178838 11 Left 1202178829 Y:22121997-22122019 CCTTGCTGGGGCCCTCCACAAAA No data
Right 1202178838 Y:22122031-22122053 TGACAAAGGGAATTCCAAAGAGG No data
1202178829_1202178835 -3 Left 1202178829 Y:22121997-22122019 CCTTGCTGGGGCCCTCCACAAAA No data
Right 1202178835 Y:22122017-22122039 AAAGGCAGGAACCATGACAAAGG No data
1202178829_1202178839 12 Left 1202178829 Y:22121997-22122019 CCTTGCTGGGGCCCTCCACAAAA No data
Right 1202178839 Y:22122032-22122054 GACAAAGGGAATTCCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202178829 Original CRISPR TTTTGTGGAGGGCCCCAGCA AGG (reversed) Intergenic
No off target data available for this crispr