ID: 1202182109

View in Genome Browser
Species Human (GRCh38)
Location Y:22148440-22148462
Sequence GAGGGTCATTCAGCCATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202182109_1202182110 -7 Left 1202182109 Y:22148440-22148462 CCAGCAATGGCTGAATGACCCTC No data
Right 1202182110 Y:22148456-22148478 GACCCTCTCCACAATGAGAAAGG No data
1202182109_1202182114 4 Left 1202182109 Y:22148440-22148462 CCAGCAATGGCTGAATGACCCTC No data
Right 1202182114 Y:22148467-22148489 CAATGAGAAAGGACCTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202182109 Original CRISPR GAGGGTCATTCAGCCATTGC TGG (reversed) Intergenic
No off target data available for this crispr