ID: 1202188511

View in Genome Browser
Species Human (GRCh38)
Location Y:22215689-22215711
Sequence GTCTTCTAATGGAAATGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 4, 1: 0, 2: 1, 3: 11, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202188511 Original CRISPR GTCTTCTAATGGAAATGTGC TGG (reversed) Intergenic
903001410 1:20268740-20268762 GTCTTCTAAAGGTGATGTGGTGG - Intergenic
910499070 1:87868099-87868121 GTCTTTTAATTGAAGTGTTCAGG - Intergenic
914797842 1:150936599-150936621 GTCTCCTGATGCACATGTGCAGG + Intronic
923270800 1:232353463-232353485 CTCATCCACTGGAAATGTGCTGG + Intergenic
924407548 1:243766373-243766395 GTCCTATGATGGAAATGTACAGG + Intronic
1064813393 10:19228678-19228700 GTGTTCTAATTGAAATGTGTTGG - Intronic
1064995570 10:21294141-21294163 TTCCCCTAATGAAAATGTGCTGG - Intergenic
1065740362 10:28791678-28791700 AGGTTCTAATGGAAATGAGCAGG + Intergenic
1071381620 10:85069152-85069174 GAGTTCTAATGGAGATGTACAGG + Intergenic
1071423984 10:85529760-85529782 GTCCTCTTATGGACATGTCCTGG + Intergenic
1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG + Intronic
1072627058 10:97119323-97119345 CTCTTTTAATGGAAAGGGGCGGG + Intronic
1074033500 10:109713469-109713491 GTCTTTTTAATGAAATGTGCTGG - Intergenic
1075109481 10:119566569-119566591 CACTCCTAATGGGAATGTGCTGG - Intergenic
1079417774 11:20255602-20255624 GACTTCACATGGAAATGAGCAGG - Intergenic
1079908680 11:26281895-26281917 GTCTTCATATGCACATGTGCTGG - Intergenic
1082703933 11:56469272-56469294 GTTTTCTTATTGAAAAGTGCAGG - Intergenic
1082761774 11:57133748-57133770 GAGCTCTAATGGAAATGTACAGG - Intergenic
1083428180 11:62600238-62600260 GACTGCAAATGGAAATGTGGAGG - Exonic
1084519392 11:69654406-69654428 GTCTTCTGCTGGAAACATGCCGG - Exonic
1087213187 11:95464220-95464242 GTCTTCTGATGCATATGAGCAGG + Intergenic
1092945547 12:13450818-13450840 GTCTGCACCTGGAAATGTGCTGG - Intergenic
1095132023 12:38554616-38554638 GTCTTCTCATCAGAATGTGCTGG - Intergenic
1095585342 12:43843504-43843526 GTCTTAAAATGAAAATGTTCAGG - Intronic
1096695713 12:53346876-53346898 GTGTTGTACTGGAAATGTGATGG - Intergenic
1097501848 12:60412774-60412796 GACTTTTAATGTAAATGTGATGG + Intergenic
1097819750 12:64116716-64116738 GTCTTCTACTGAAAATGTACAGG + Intronic
1098113971 12:67155046-67155068 ATCTTCTTATGCACATGTGCTGG - Intergenic
1100008412 12:89922558-89922580 GTGTTCTGATGGAAATGTCCTGG + Intergenic
1100177112 12:92043448-92043470 GTCCTCTGATGGAAATGTTGGGG + Intronic
1104395866 12:128432153-128432175 GAGTTCTGATGGATATGTGCAGG + Intronic
1105781486 13:23708680-23708702 GTCTTTTAATGCAAATATCCAGG + Intergenic
1105791542 13:23805085-23805107 GTCTTGTAACTGAAAGGTGCAGG - Intronic
1106903103 13:34375903-34375925 GGCTACTAGTGAAAATGTGCTGG + Intergenic
1107474881 13:40726426-40726448 GTCTTTTAATGAAAGTTTGCTGG + Intergenic
1107766725 13:43743383-43743405 GTCTTCCAGTGAAAATGTTCTGG - Intronic
1109345618 13:61112168-61112190 GTATTCTCAGGGAAAGGTGCAGG + Intergenic
1112269850 13:97958643-97958665 GTTTTCTTTTGGAAATGAGCTGG - Intronic
1118611781 14:67547110-67547132 GTCTTCACATGGAAATGTTAGGG + Intronic
1118618952 14:67597175-67597197 GTCTTTTAATGAAAATGTTTGGG + Intronic
1118761267 14:68881581-68881603 GTCTACTAAGGACAATGTGCTGG + Intronic
1120649108 14:87109742-87109764 CGCTTCTAATTGAAATGTGGTGG - Intergenic
1125161298 15:36647612-36647634 GCCTTTTGTTGGAAATGTGCAGG + Intronic
1128223995 15:65989159-65989181 GTCCTCTCAGGGAGATGTGCAGG + Intronic
1132364824 15:101249906-101249928 GGACCCTAATGGAAATGTGCAGG + Intronic
1135396738 16:22137405-22137427 GTCTCATAATGGAAGGGTGCTGG + Intronic
1140242364 16:73214737-73214759 TTCTTCAAATGGAAATTTTCTGG + Intergenic
1140258965 16:73360870-73360892 TTTTTCTAATGGAACCGTGCAGG + Intergenic
1143332331 17:6146918-6146940 ATGTTCTAATGGAGATGGGCAGG - Intergenic
1144424220 17:15126146-15126168 CTCTTCTAATAGATGTGTGCTGG - Intergenic
1149223660 17:54443425-54443447 GTTTTCCAATGGGGATGTGCTGG + Intergenic
1153286595 18:3461475-3461497 GTGATCTAATGTAAATTTGCTGG - Intergenic
1153510082 18:5842413-5842435 GTCTGCTAATGAACAGGTGCTGG + Intergenic
1155459850 18:26066379-26066401 GACTTCAAATGGAGATGTGAAGG - Intronic
1155999951 18:32373508-32373530 GTCTTCTTAGGAAAATGTGAAGG - Intronic
1156389130 18:36634311-36634333 GCCTACTTATGGAACTGTGCTGG + Intronic
1157503625 18:48209216-48209238 GGCTCCAAACGGAAATGTGCAGG + Intronic
1159193170 18:65075154-65075176 GGCTTTTAATGGATATGTCCTGG + Intergenic
1159734147 18:72073605-72073627 ATCTTCTAAGGGAAGTGTGTAGG + Intergenic
1160483654 18:79267028-79267050 TTCTTCTTATGTAAATGTTCAGG - Intronic
925701699 2:6645543-6645565 GGGTTCTAGAGGAAATGTGCTGG - Intergenic
931117632 2:59182000-59182022 TTCTTTTAAAGGAAATGTCCAGG - Intergenic
933127472 2:78627425-78627447 GTCTTCTAAAGGAAATTTTCTGG - Intergenic
934853524 2:97715619-97715641 GTCTCCTAATAGACATTTGCTGG + Intronic
935420117 2:102858649-102858671 GTCTTATGCTGGATATGTGCAGG - Intergenic
935487959 2:103681350-103681372 ATCTTCTTAGGGAGATGTGCAGG + Intergenic
937425751 2:121797149-121797171 TTCTTCTAATGGAGAGGTGTCGG + Intergenic
942091162 2:172492780-172492802 GTCTACTTATGGAAATGTTCTGG + Intronic
942815062 2:180043185-180043207 GTCTTTTTATGAAAATGTACTGG + Intergenic
942817007 2:180063771-180063793 TTTTTCTAGTGGAATTGTGCAGG + Intergenic
944757449 2:202778189-202778211 GTCTTCTTATGGAAATGCAATGG + Exonic
945911809 2:215658585-215658607 GTCTTCTATTGGAAATACTCCGG - Intergenic
946523003 2:220486859-220486881 GTCTTATAAAGGAAATGTGATGG + Intergenic
946683033 2:222237860-222237882 GTCTTCTGAAGCAAAAGTGCAGG + Intronic
946961918 2:224994331-224994353 GTCTTCTGAGGGAAGTGTGAAGG - Intronic
948468099 2:238161794-238161816 GTGTGCTATTGGAAATGTTCAGG - Intronic
1171856228 20:30345956-30345978 GAGTTCTAATGGAGATGTACAGG + Intergenic
1172493881 20:35363963-35363985 TTCTTCTAATGGAATCGTGCAGG - Intronic
1173121641 20:40295192-40295214 GTCTTATAGTGCAAATCTGCTGG - Intergenic
1173594517 20:44249953-44249975 GTCTTCTAAAGGAATTCTGCAGG - Intronic
1174805071 20:53598293-53598315 GTCTGCTGTTGGAAATGTGTTGG + Intronic
951703270 3:25518009-25518031 GGCTGCTAATGGAAATATTCTGG + Intronic
956248200 3:67207915-67207937 GTTTTCAGTTGGAAATGTGCTGG - Intergenic
958927840 3:100178641-100178663 GGCTTCTGATGTAACTGTGCAGG + Intergenic
960302499 3:116020990-116021012 GTCTCCTAATGAAGATTTGCAGG - Intronic
961974342 3:131007185-131007207 CTTTTCTAATGTAAATCTGCTGG + Intronic
963074595 3:141334303-141334325 ATCTTCTCATGGGAATGTGAGGG + Intronic
964345504 3:155750824-155750846 GTCTACAAATGGAAATGTTTTGG + Intergenic
965702608 3:171473382-171473404 GTTTTCTGATGGATATGTCCTGG + Intergenic
966681225 3:182643996-182644018 GTCTTTGAATAGAAATCTGCAGG + Intergenic
970640936 4:18065303-18065325 CTCTTCTAATGAAGATTTGCTGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973976223 4:56265092-56265114 CTGTCATAATGGAAATGTGCTGG + Intronic
974419442 4:61653514-61653536 CTCTTTTAATGGAAAAGTCCAGG + Intronic
975620550 4:76292076-76292098 GTCTACTAATAAAAATGTCCTGG - Intronic
975624195 4:76326858-76326880 TTCTTTTAATGTAAATCTGCTGG - Intronic
984856972 4:184203861-184203883 GGCTGCTAATGGAAAAATGCAGG - Intronic
987760687 5:22159370-22159392 ATTTTCTAATGAAAATGTGTAGG - Intronic
988939150 5:36124683-36124705 CTCTTCTATTGGAAAAGAGCTGG - Intronic
991895461 5:71392821-71392843 ATTTTCTAATGAAAATGTGTAGG - Intergenic
992537990 5:77731041-77731063 TTCATCTAAAGGAAATCTGCAGG - Intronic
993314406 5:86382481-86382503 GTGTTGGAATGGAAATGTGGAGG - Intergenic
993936173 5:94005694-94005716 GTTTTCTAATGGAATTGTTTGGG - Intronic
993989651 5:94640170-94640192 TTCTTATAATGTAAGTGTGCTGG + Intronic
995102304 5:108327339-108327361 GGCTTATAACTGAAATGTGCTGG - Intronic
995696671 5:114885682-114885704 GTCTTCTACTGGAGGTGGGCTGG - Intergenic
996445462 5:123544108-123544130 CTCTGCTAATAGAAAAGTGCAGG + Intronic
997190903 5:131934474-131934496 GTCTTTTAAACAAAATGTGCTGG + Intronic
999829447 5:155304782-155304804 GTCTTATAATGGAAATATCATGG - Intergenic
1000124170 5:158227172-158227194 GTTTTCAACTGGAAGTGTGCTGG + Intergenic
1005129662 6:22491284-22491306 GTCTTCTACTTGAACTGTCCTGG - Intergenic
1005290330 6:24373258-24373280 GTCTCCTGATGCACATGTGCAGG - Intergenic
1006992985 6:38231569-38231591 GTCTTCTACTGGCATTGTGATGG - Intronic
1008657446 6:53630258-53630280 GTCTTAAAATGGAAAGGTTCTGG - Intergenic
1008789166 6:55208574-55208596 GTCTTTTGATGGAAATGAGAGGG + Intronic
1009328727 6:62387605-62387627 TTCTTATAATGCAAGTGTGCTGG + Intergenic
1009940675 6:70283979-70284001 GTTTTCTAATGGAAATGGGTTGG + Intronic
1010401120 6:75447430-75447452 GTATCCTAAAGAAAATGTGCAGG + Intronic
1013567832 6:111386176-111386198 GTCTCCTTATGGCTATGTGCAGG - Intronic
1016544786 6:145208835-145208857 ATGTTATAATGGCAATGTGCAGG - Intergenic
1016555190 6:145328313-145328335 GTCTTCTACAGGAAAACTGCTGG - Intergenic
1017125274 6:151058981-151059003 AGCTTCTAAAGGAAATGTGTTGG + Intronic
1017281770 6:152633491-152633513 GTATTGTAATGGAAAAGTCCAGG + Intronic
1019751638 7:2734444-2734466 GTGTTCTCATGGAAATGTACAGG + Intronic
1021478870 7:21093769-21093791 GTCTCCTAATGAGAATGTACAGG + Intergenic
1023442367 7:40197317-40197339 GTAATCTAATGGAAATGTTGAGG + Intronic
1028687727 7:93611317-93611339 TTCTTCTATAGGAAAAGTGCAGG + Intronic
1031191243 7:118553824-118553846 ATCTACTAATGAAATTGTGCAGG + Intergenic
1033998096 7:147377559-147377581 GGCTTTTAATGGGAATGTGTTGG + Intronic
1034307989 7:150061585-150061607 GTCTTATAAGGGAAAAGTCCTGG + Intergenic
1034798864 7:154039086-154039108 GTCTTATAAGGGAAAAGTCCTGG - Intronic
1036459995 8:8943901-8943923 GTCTTATAAAGGAAGTGTTCTGG + Intergenic
1038677406 8:29635813-29635835 GTCTTAAAATTGAAATATGCCGG - Intergenic
1038691481 8:29767715-29767737 GTCTTCTCATGCAGAAGTGCAGG - Intergenic
1039990721 8:42485328-42485350 GTTTTCTAAAGGAAAAATGCAGG - Intronic
1040136890 8:43864865-43864887 GTTTTTTAATGGAAATATTCAGG - Intergenic
1040852764 8:51919052-51919074 TCCTTCTCTTGGAAATGTGCAGG + Intergenic
1041521300 8:58759298-58759320 GTCTTTTAATGAAAATCTGTCGG - Intergenic
1041808222 8:61877923-61877945 GTCAAATAGTGGAAATGTGCAGG + Intergenic
1044446947 8:92289355-92289377 GTCTTCCAATGGAAATATATGGG + Intergenic
1047888332 8:129278372-129278394 TTCTTCTAATGGAAACGTCATGG - Intergenic
1050566867 9:6893938-6893960 GGCTTTTAAGGGAAAGGTGCAGG + Intronic
1059046926 9:110879051-110879073 TTCTTCTATCAGAAATGTGCTGG - Intronic
1060083723 9:120677784-120677806 GTATACTAATGGAAAAGTGGTGG - Intronic
1186388109 X:9130563-9130585 GTCTGCAAATGGAGATGAGCAGG + Intronic
1186400149 X:9250408-9250430 AGCCTCAAATGGAAATGTGCTGG - Intergenic
1192237573 X:69305823-69305845 GGCTCCAAATGCAAATGTGCGGG - Intergenic
1194077014 X:89407684-89407706 TTCTGCTAATGGGAATGTGGCGG - Intergenic
1195251222 X:103050272-103050294 GGTTTCTAATGTAAATGTGAAGG + Intergenic
1195864705 X:109417671-109417693 GTCTTCTAATTGAAATGTTTAGG - Intronic
1200024310 X:153242817-153242839 GCCTTCTAATGTATAAGTGCTGG + Intergenic
1200429657 Y:3063219-3063241 TTCTGCTAATGGGAATGTGGCGG - Intergenic
1200874753 Y:8141488-8141510 GATTTCTAATGGAAATGTGCTGG - Intergenic
1200907973 Y:8504570-8504592 ATTTTCCAATGGAAATGTGTTGG - Intergenic
1200987253 Y:9315602-9315624 ATTTTCCAATGGAAATGTGTTGG + Intergenic
1202101737 Y:21315901-21315923 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202108638 Y:21398163-21398185 ATTTTCCAATGGAAATGTGTTGG + Intergenic
1202118334 Y:21497045-21497067 ATTTTCCAATGGAAATGTGTTGG - Intergenic
1202120786 Y:21520585-21520607 ATTTTCCAATGGAAATGTGTTGG - Intronic
1202123237 Y:21544126-21544148 ATTTTCCAATGGAAATGTGTTGG - Intronic
1202155769 Y:21885255-21885277 ATTTTCCAATGGAAATGTGTTGG + Intronic
1202158217 Y:21908796-21908818 ATTTTCCAATGGAAATGTGTTGG + Intronic
1202160518 Y:21930225-21930247 ATTTTCCAATGGAAATGTGTTGG + Intergenic
1202184670 Y:22173721-22173743 ATTTTCCAATGGAAATGTGTTGG + Intronic
1202187562 Y:22202869-22202891 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202188511 Y:22215689-22215711 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202203798 Y:22383527-22383549 GTCTTCTAATGGAAATGTGCTGG + Intronic
1202206690 Y:22412680-22412702 ATTTTCCAATGGAAATGTGTTGG - Intronic
1202230838 Y:22656150-22656172 ATTTTCCAATGGAAATGTGTTGG - Intergenic
1202312320 Y:23540015-23540037 ATTTTCCAATGGAAATGTGTTGG + Intergenic
1202558483 Y:26130579-26130601 ATTTTCCAATGGAAATGTGTTGG - Intergenic