ID: 1202194472

View in Genome Browser
Species Human (GRCh38)
Location Y:22284505-22284527
Sequence CCTGAAATCCAGAACATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202194472_1202194478 17 Left 1202194472 Y:22284505-22284527 CCCTCCATGTTCTGGATTTCAGG No data
Right 1202194478 Y:22284545-22284567 TGTTCCCAACATGGACTACAAGG No data
1202194472_1202194476 8 Left 1202194472 Y:22284505-22284527 CCCTCCATGTTCTGGATTTCAGG No data
Right 1202194476 Y:22284536-22284558 TTTAGCCTGTGTTCCCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202194472 Original CRISPR CCTGAAATCCAGAACATGGA GGG (reversed) Intergenic
No off target data available for this crispr