ID: 1202194476

View in Genome Browser
Species Human (GRCh38)
Location Y:22284536-22284558
Sequence TTTAGCCTGTGTTCCCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202194472_1202194476 8 Left 1202194472 Y:22284505-22284527 CCCTCCATGTTCTGGATTTCAGG No data
Right 1202194476 Y:22284536-22284558 TTTAGCCTGTGTTCCCAACATGG No data
1202194468_1202194476 16 Left 1202194468 Y:22284497-22284519 CCCCTAAGCCCTCCATGTTCTGG No data
Right 1202194476 Y:22284536-22284558 TTTAGCCTGTGTTCCCAACATGG No data
1202194474_1202194476 7 Left 1202194474 Y:22284506-22284528 CCTCCATGTTCTGGATTTCAGGA No data
Right 1202194476 Y:22284536-22284558 TTTAGCCTGTGTTCCCAACATGG No data
1202194471_1202194476 14 Left 1202194471 Y:22284499-22284521 CCTAAGCCCTCCATGTTCTGGAT No data
Right 1202194476 Y:22284536-22284558 TTTAGCCTGTGTTCCCAACATGG No data
1202194470_1202194476 15 Left 1202194470 Y:22284498-22284520 CCCTAAGCCCTCCATGTTCTGGA No data
Right 1202194476 Y:22284536-22284558 TTTAGCCTGTGTTCCCAACATGG No data
1202194475_1202194476 4 Left 1202194475 Y:22284509-22284531 CCATGTTCTGGATTTCAGGATAT No data
Right 1202194476 Y:22284536-22284558 TTTAGCCTGTGTTCCCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202194476 Original CRISPR TTTAGCCTGTGTTCCCAACA TGG Intergenic
No off target data available for this crispr