ID: 1202199289

View in Genome Browser
Species Human (GRCh38)
Location Y:22330127-22330149
Sequence TAGCATGACTCAGATAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202199284_1202199289 -8 Left 1202199284 Y:22330112-22330134 CCATGGTGCCATGGCTAGCATGA 0: 2
1: 15
2: 6
3: 6
4: 158
Right 1202199289 Y:22330127-22330149 TAGCATGACTCAGATAGTGGGGG 0: 1
1: 0
2: 5
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202199289 Original CRISPR TAGCATGACTCAGATAGTGG GGG Intronic
900791359 1:4683082-4683104 TGGCAAGAGTCAGATGGTGGGGG + Intronic
907109639 1:51915093-51915115 GAGCATGAGTCAGACAGAGGAGG + Exonic
907695457 1:56722631-56722653 TAGCAAGACAAAGATAGAGGTGG + Intronic
908230561 1:62100651-62100673 TACAATGACTCAGAAAGGGGAGG - Intronic
909175153 1:72347921-72347943 TAGCTTGAGTAACATAGTGGTGG + Intergenic
910333692 1:86104942-86104964 TAGCATGACTCAGGAAGGTGGGG + Intronic
913274426 1:117122950-117122972 TAGCATGAAACAGATAATGAAGG - Intergenic
914566357 1:148870944-148870966 TAGCAGTACTCAGAGAGAGGAGG + Intronic
914606462 1:149259296-149259318 TAGCAGTACTCAGAGAGAGGAGG - Intergenic
916273687 1:162970675-162970697 TAGCATGACTGAGAGAGTACTGG + Intergenic
917826192 1:178823704-178823726 TGGCATGAATCAGATAATGGAGG + Intronic
917959701 1:180132448-180132470 AAGCATGACTAAGATGATGGTGG - Intergenic
921957936 1:221003454-221003476 TAGCAGGCCACAGATAGAGGAGG - Intergenic
1083087993 11:60169842-60169864 TAGGATGACTCAGACTGTGTAGG - Intergenic
1086453539 11:86940155-86940177 CAGCATGACACTGTTAGTGGAGG - Intronic
1090228236 11:125084279-125084301 GAGCATGACACAGCAAGTGGTGG - Exonic
1090447359 11:126775735-126775757 TAGCCTGACACAGATCTTGGAGG + Intronic
1093250281 12:16794369-16794391 CAGCACCACTCAGATAGGGGAGG - Intergenic
1106436605 13:29729071-29729093 TAGCTTGGCTCAGATGGTGGTGG - Intergenic
1108634579 13:52320059-52320081 GAGCATGAGTCACATGGTGGAGG - Intergenic
1115402868 14:32982817-32982839 TAATATCACTCAGATGGTGGAGG + Intronic
1117564410 14:56978561-56978583 TGGCATGACTCACATCGTGCAGG + Intergenic
1124809254 15:32917949-32917971 TAGCATGAATTAAATAATGGTGG - Intronic
1134881905 16:17752368-17752390 TTGAAGGACTCAGATGGTGGTGG - Intergenic
1135815997 16:25634231-25634253 CAGAAAGACTCAGGTAGTGGGGG + Intergenic
1139087111 16:63600248-63600270 TCTCATGACTCTGATATTGGTGG - Intergenic
1140505578 16:75470044-75470066 TTGCAGGACTCAGAAAATGGAGG + Intergenic
1150302260 17:64056316-64056338 TAGCATGGCTGAGCCAGTGGTGG + Intronic
1150918774 17:69461741-69461763 AAGTCTAACTCAGATAGTGGAGG + Intronic
1153061638 18:1001151-1001173 TAGATTGAATTAGATAGTGGGGG + Intergenic
1156331319 18:36126544-36126566 GACCATGACTCAGATAGTTCAGG - Exonic
1166232363 19:41432338-41432360 TGGCCTCACTCAGATATTGGTGG - Exonic
929094517 2:38250784-38250806 TGGAATCCCTCAGATAGTGGTGG - Intergenic
929876753 2:45803124-45803146 TAACATGTCTCAGACCGTGGTGG + Intronic
931093391 2:58912071-58912093 TTGCATGACACAGATGGTAGGGG - Intergenic
932233620 2:70103148-70103170 TAGCATTTCTCAAAGAGTGGTGG - Intergenic
937445259 2:121952180-121952202 AAGCATGAATGAGACAGTGGTGG + Intergenic
937566908 2:123304520-123304542 TAGCATGACTAAAATAGTGAAGG - Intergenic
943394482 2:187316337-187316359 TAGAATGAATCAGAAAGTAGAGG - Intergenic
945616408 2:212074087-212074109 AAGCATGAGTCAAATAGTGTAGG + Intronic
947452962 2:230225319-230225341 TAGCATGCATTAGAAAGTGGGGG - Intronic
1170635279 20:18099062-18099084 TAGAATGGCTCAGATAGCCGAGG + Intergenic
1172652734 20:36515904-36515926 AAGAATGTCTCAGATAGTGATGG + Intronic
1173993536 20:47320747-47320769 TAACATCACTCAGATAGTAGTGG + Intronic
1177073025 21:16534719-16534741 TAACATGGCTCAGAAAATGGTGG + Intergenic
1181411226 22:22721195-22721217 GAGGATGACACAGATAGTGAAGG - Intergenic
1182453749 22:30436335-30436357 TGGCAGGACTCAGACAGGGGTGG + Intergenic
1183679352 22:39318421-39318443 TGGCATGACTCACATCGTGCGGG - Exonic
950682338 3:14593930-14593952 TTGCATGACCCTGATGGTGGGGG + Intergenic
951273098 3:20651537-20651559 GAGCATGATTCAGATAATGGTGG + Intergenic
952519853 3:34145679-34145701 TAGGATGACTTGGAAAGTGGTGG - Intergenic
954332972 3:49900689-49900711 TAGCATGACTCAGGGACAGGTGG + Intronic
960422381 3:117462942-117462964 TCCCATGACTCAGGTAGTGAAGG - Intergenic
967950150 3:194834384-194834406 TTGCATGACTTAGAAAATGGGGG + Intergenic
970444242 4:16110548-16110570 CAGCAAGACCAAGATAGTGGAGG + Intergenic
984069738 4:175095310-175095332 TAGCATGACTCTGATTTTGAGGG - Intergenic
985489884 5:173007-173029 TAGCAAGACCCAGAAGGTGGAGG + Exonic
987109072 5:14667915-14667937 CAGCAGGAGTCAGATATTGGGGG - Intronic
987308908 5:16664257-16664279 AGGCATGACTCAGATTGGGGGGG - Intronic
989678082 5:43996527-43996549 TATAATGACTCAGAGAGGGGAGG - Intergenic
992258001 5:74941415-74941437 TAGCTTCAGTGAGATAGTGGGGG + Intergenic
994003523 5:94809893-94809915 TAGCATTAGTGAGATAGTCGTGG - Intronic
994956738 5:106542634-106542656 AAGCCTGACTCAGGTAGTGGTGG + Intergenic
1000487863 5:161870481-161870503 TAGCTTGACTCAGGAGGTGGAGG + Intronic
1000827395 5:166062332-166062354 TAGGATGAAACAGATAGTGCAGG - Intergenic
1001555166 5:172632193-172632215 GAGCATGAGCCAGATTGTGGTGG + Intergenic
1002835542 6:861961-861983 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835553 6:862058-862080 TAACATGACTCAGGAAGTGGTGG - Intergenic
1002835564 6:862155-862177 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835575 6:862252-862274 TAACATGACTCAGGAAGTGGTGG - Intergenic
1002835586 6:862349-862371 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835597 6:862446-862468 TAACATGACTCAGGAAGTGGTGG - Intergenic
1002835608 6:862543-862565 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835619 6:862640-862662 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835630 6:862737-862759 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835641 6:862834-862856 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835652 6:862931-862953 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835663 6:863028-863050 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835674 6:863125-863147 TAACATGACTCAGGAAGTGGTGG - Intergenic
1002835685 6:863222-863244 TAACATGACTCAGGAAGTGGTGG - Intergenic
1002835696 6:863319-863341 TAATATGACTCAGGAAGTGGCGG - Intergenic
1002835707 6:863416-863438 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835718 6:863513-863535 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835729 6:863610-863632 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002835740 6:863707-863729 TAATATGACTCAGGAAGTGGTGG - Intergenic
1002892619 6:1348731-1348753 AGGCATGAGTCAGATAGTAGAGG + Intergenic
1004453557 6:15770231-15770253 TAGCATTACTCAGATAATTATGG - Intergenic
1005787686 6:29263149-29263171 TAGCATGACTCTGGTCGGGGAGG - Intergenic
1006008062 6:31018898-31018920 CTGCATCACTCAGATAGAGGAGG - Intronic
1010746993 6:79574830-79574852 TGGGATGACTCAGATGGTTGGGG + Intergenic
1011826367 6:91310143-91310165 AAGTATGCATCAGATAGTGGTGG + Intergenic
1012650666 6:101748590-101748612 TAGCAGGACTCAGAGTCTGGTGG - Intronic
1012960216 6:105614548-105614570 TAGCATGGTTCAGATAATGAAGG + Intergenic
1016864242 6:148749248-148749270 TAGCAGGTGTCAGAGAGTGGAGG - Intronic
1017821838 6:158054541-158054563 TAGGATGACTCAGATTTTAGGGG + Intronic
1021085241 7:16415068-16415090 CAACATGCCTCAGATACTGGTGG + Intronic
1024279900 7:47710306-47710328 CAGCGTGATTCAGACAGTGGCGG - Intronic
1027966838 7:85022442-85022464 CAGACTGACACAGATAGTGGTGG - Exonic
1028441776 7:90871113-90871135 ATTAATGACTCAGATAGTGGTGG + Intronic
1031113840 7:117645613-117645635 TTGTATGACTCATATAATGGAGG - Intronic
1033366343 7:140674709-140674731 TAGCTTGCCTGAGATTGTGGAGG + Exonic
1034079608 7:148263962-148263984 TGGCATGACCCACACAGTGGAGG - Intronic
1036062106 8:5335016-5335038 TAAGATGACGCAGATAGTGTAGG - Intergenic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1041761210 8:61368509-61368531 TAGCATTGGTCAGATAGGGGTGG + Intronic
1047165659 8:122435644-122435666 TAGCGTAACACAGATAGTGATGG + Intergenic
1049184149 8:141240485-141240507 GAGCGTGACTCAGAGACTGGGGG + Intronic
1059486318 9:114629732-114629754 TTGCCTGACTCAGAAAGAGGGGG + Intronic
1062536228 9:137022190-137022212 GGGCATGGCTCAGAGAGTGGGGG + Intronic
1187005174 X:15225680-15225702 AAGCATGACTCACAGAGTTGTGG - Intergenic
1195137396 X:101922782-101922804 AATCATGTCTCAAATAGTGGGGG - Intronic
1198579692 X:138049573-138049595 TAGCAACACTCTGATGGTGGTGG - Intergenic
1200695912 Y:6359385-6359407 TAGCATAACTCAAATAGTGGAGG + Intergenic
1200827939 Y:7662288-7662310 TAGCATAACTCAAATAGCAGGGG - Intergenic
1200884696 Y:8255568-8255590 TAGCATAACTCACATATCGGGGG - Intergenic
1200940927 Y:8780912-8780934 TAGCATGACTCAAATAGTAAGGG - Intergenic
1200953840 Y:8926292-8926314 TAGCATGACTCAAATAGCGGGGG + Intergenic
1200986654 Y:9307985-9308007 TAGCGTGACTCAAATAGCAGGGG - Intergenic
1201023619 Y:9683606-9683628 TAGCATAACTCAAATAGTGGAGG + Intergenic
1201039365 Y:9815321-9815343 TAGCATAACTCAAATAGTGGAGG - Intergenic
1201057882 Y:10013965-10013987 TAGCATGACTCAAATAGCGGGGG - Intergenic
1202107656 Y:21386980-21387002 TAGCATGACTCAAATAGCTGGGG - Intergenic
1202119035 Y:21505824-21505846 TAGCGTGACTCAAATAGCAGGGG + Intergenic
1202121487 Y:21529364-21529386 TAGCGTGACTCAAATAGCAGGGG + Intronic
1202123934 Y:21552933-21552955 TAGCGTGACTCAAATAGCAGGGG + Intergenic
1202155074 Y:21876447-21876469 TAGCGTGACTCAAATAGCAGGGG - Intergenic
1202157516 Y:21900018-21900040 TAGCGTGACTCAAATAGCAGGGG - Intronic
1202159965 Y:21923559-21923581 TAGCGTGACTCAAATAGCAGGGG - Intergenic
1202199289 Y:22330127-22330149 TAGCATGACTCAGATAGTGGGGG + Intronic