ID: 1202209251

View in Genome Browser
Species Human (GRCh38)
Location Y:22437962-22437984
Sequence GAGGGTCATTCAGCCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202209246_1202209251 4 Left 1202209246 Y:22437935-22437957 CCACTGTAGGTCCTTTCTCATTG No data
Right 1202209251 Y:22437962-22437984 GAGGGTCATTCAGCCATTGCTGG No data
1202209250_1202209251 -7 Left 1202209250 Y:22437946-22437968 CCTTTCTCATTGTGGAGAGGGTC No data
Right 1202209251 Y:22437962-22437984 GAGGGTCATTCAGCCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202209251 Original CRISPR GAGGGTCATTCAGCCATTGC TGG Intergenic
No off target data available for this crispr