ID: 1202213536

View in Genome Browser
Species Human (GRCh38)
Location Y:22472519-22472541
Sequence CTGCAATCCTGGGGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202213536_1202213542 -9 Left 1202213536 Y:22472519-22472541 CCATTTTTTCCCCAGGATTGCAG No data
Right 1202213542 Y:22472533-22472555 GGATTGCAGTCTCCCAGGTAGGG No data
1202213536_1202213546 28 Left 1202213536 Y:22472519-22472541 CCATTTTTTCCCCAGGATTGCAG No data
Right 1202213546 Y:22472570-22472592 ATGCAGCCTCTAGAGCTGCCAGG No data
1202213536_1202213541 -10 Left 1202213536 Y:22472519-22472541 CCATTTTTTCCCCAGGATTGCAG No data
Right 1202213541 Y:22472532-22472554 AGGATTGCAGTCTCCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202213536 Original CRISPR CTGCAATCCTGGGGAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr