ID: 1202215716

View in Genome Browser
Species Human (GRCh38)
Location Y:22489725-22489747
Sequence AAGTATCTGCATCTTGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202215713_1202215716 -8 Left 1202215713 Y:22489710-22489732 CCGTTGCCTAGCAAGAAGTATCT No data
Right 1202215716 Y:22489725-22489747 AAGTATCTGCATCTTGGAAAAGG No data
1202215712_1202215716 30 Left 1202215712 Y:22489672-22489694 CCGATTGTGAGCTCTGTCTAGCA No data
Right 1202215716 Y:22489725-22489747 AAGTATCTGCATCTTGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202215716 Original CRISPR AAGTATCTGCATCTTGGAAA AGG Intergenic
No off target data available for this crispr