ID: 1202216784

View in Genome Browser
Species Human (GRCh38)
Location Y:22500776-22500798
Sequence CCCAGTGTGTACCCCGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 2, 1: 2, 2: 1, 3: 20, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202216781_1202216784 -9 Left 1202216781 Y:22500762-22500784 CCAGCCACATAAGACCCAGTGTG 0: 2
1: 2
2: 2
3: 10
4: 150
Right 1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG 0: 2
1: 2
2: 1
3: 20
4: 57
1202216775_1202216784 28 Left 1202216775 Y:22500725-22500747 CCAAGATTTGGAATGTCCCAGGT 0: 4
1: 0
2: 1
3: 11
4: 151
Right 1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG 0: 2
1: 2
2: 1
3: 20
4: 57
1202216780_1202216784 11 Left 1202216780 Y:22500742-22500764 CCAGGTTAGTGTTGGGGAAACCA 0: 6
1: 0
2: 0
3: 11
4: 137
Right 1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG 0: 2
1: 2
2: 1
3: 20
4: 57
1202216779_1202216784 12 Left 1202216779 Y:22500741-22500763 CCCAGGTTAGTGTTGGGGAAACC 0: 8
1: 0
2: 0
3: 11
4: 121
Right 1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG 0: 2
1: 2
2: 1
3: 20
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202216784 Original CRISPR CCCAGTGTGTACCCCGAATC TGG Intronic
902777934 1:18686443-18686465 CCTACTGCGTACCCCGAATCTGG + Intronic
912930477 1:113954738-113954760 CACAGTGGGTACCCCAAATTAGG - Exonic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
924613202 1:245590538-245590560 CCCAGTGTTTACCAAAAATCAGG + Intronic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
924792583 1:247266459-247266481 CCCAGTGGGCACCCCAATTCCGG - Intergenic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1081366763 11:42244532-42244554 CCCAGTGTGTCCCTGGAATTTGG + Intergenic
1088329254 11:108633451-108633473 CCCAGTGTGTAGGACAAATCTGG + Intergenic
1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG + Intronic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1120350002 14:83342876-83342898 CACAGTGGGTACGCCCAATCAGG + Intergenic
1129114878 15:73359743-73359765 CTCAGTGTGTGACCAGAATCAGG - Intronic
1129193369 15:73950649-73950671 CCCAGTGTGTAGCCAGGCTCAGG + Intronic
1132095086 15:98978254-98978276 CCCAGAGTGGAACCCGAAACTGG + Intronic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1136656062 16:31710002-31710024 CCCATTGTCTACACCTAATCTGG + Intergenic
1137608945 16:49806145-49806167 CCCAGTGTTGCCCCCGAAACAGG - Intronic
1141101270 16:81199152-81199174 CCAAGTTTGTATCCAGAATCAGG - Intergenic
1143362594 17:6383897-6383919 CCCAGTGTGAGCCCAGATTCTGG - Intergenic
1146939749 17:36836321-36836343 CCCAGTGTGTCCCTAGAATCTGG - Intergenic
1147121430 17:38337534-38337556 CCCAGTGTCTCACCCCAATCTGG + Intronic
1147325578 17:39668016-39668038 CCCAGTCTCCACCTCGAATCAGG + Intronic
1148552535 17:48559148-48559170 CCCACTGGGTACCCAGTATCAGG + Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1153498985 18:5729195-5729217 CCAAGTGTGTACCACGCAGCAGG - Intergenic
1153814737 18:8782791-8782813 CCCAGTGTGTACCCAGAGCTCGG + Intronic
927444827 2:23149933-23149955 CCCATTGTGTGCCTCGAGTCTGG - Intergenic
932075890 2:68662613-68662635 CCCAGTGTGTTGACCAAATCAGG + Intergenic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
1169337819 20:4771541-4771563 CACAGTGTCTACCAAGAATCAGG + Intergenic
1175258834 20:57662662-57662684 CCCTGTGTGTACCCTGAATGCGG - Intronic
952981478 3:38739454-38739476 CACAGTGTCTTCCCTGAATCTGG + Intronic
957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG + Intergenic
960531125 3:118766228-118766250 CCTAGTCTCTACCCCTAATCTGG + Intergenic
962813748 3:138980278-138980300 CCCTGTGTGCACTCCGAATCCGG - Intergenic
970844509 4:20520400-20520422 GCCAGTGTGTGCCCCAAATGAGG - Intronic
973862601 4:55079957-55079979 CTCAGTGTGGTCCCCGAGTCAGG + Exonic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
993690581 5:90995390-90995412 GCCAGAGTGTACCCAGAATGAGG + Intronic
1003740396 6:8930620-8930642 CCCATTGTGTACCAGGAATGAGG - Intergenic
1004019867 6:11767724-11767746 CCCACTGTGTACCCCACACCAGG + Intronic
1004256860 6:14072228-14072250 CCCAGTGTATTCACCGAATGTGG - Intergenic
1007925641 6:45647438-45647460 GCCAGTGTGTATCCCTGATCTGG + Intronic
1019191597 6:170254385-170254407 CCCAGTGTGTGCCAAGAACCAGG + Intergenic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1023519011 7:41032204-41032226 AGCAGTGTGTACCCCAAGTCTGG - Intergenic
1026972314 7:74475896-74475918 CCCAATGTGTACTCCAGATCAGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1033542205 7:142367526-142367548 ACCAGTGTGTGCCCTGAATGTGG - Intergenic
1033669104 7:143472697-143472719 CCCAGCGGGTACTCCGAGTCCGG - Intergenic
1034258126 7:149735551-149735573 CCCAGTGTGTCCCTCAAGTCAGG + Intergenic
1036670921 8:10786882-10786904 CCCACTGTGGACCCCTAATGGGG + Intronic
1039978374 8:42386061-42386083 CTCAGTGTATACCTCCAATCCGG - Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1042356479 8:67833995-67834017 CCCATTGTGTACCCTAAAGCAGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1044854387 8:96459417-96459439 CCCAGTGTGTCTCCCCAAGCTGG - Intergenic
1049413214 8:142483001-142483023 CTCAGTGTGTGACCAGAATCAGG - Intronic
1049466750 8:142754540-142754562 CTCAGTGTGTGACCAGAATCTGG + Intergenic
1055240673 9:74182738-74182760 ACCAGTGTGTACCTAGAATTGGG - Intergenic
1057393117 9:94655646-94655668 CACAGTGTCCACCCAGAATCTGG + Intergenic
1190652094 X:52577391-52577413 CCCAGGTTGTTCCCCGACTCTGG + Intergenic
1200971264 Y:9155008-9155030 TCCAGTGTATACCCCCAATCAGG - Intergenic
1201776467 Y:17671239-17671261 CCCAGTGGGTACACTGACTCTGG + Intergenic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1201825089 Y:18234753-18234775 CCCAGTGGGTACACTGACTCTGG - Intergenic
1202139758 Y:21709291-21709313 TCCAGTGTATGCCCCCAATCAGG + Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202216784 Y:22500776-22500798 CCCAGTGTGTACCCCGAATCTGG + Intronic
1202326403 Y:23695294-23695316 CCCAGTGTGTACCCCGAATCTGG - Intergenic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic