ID: 1202219243

View in Genome Browser
Species Human (GRCh38)
Location Y:22525533-22525555
Sequence CACCTAGAATTATCTAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202219243_1202219247 15 Left 1202219243 Y:22525533-22525555 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202219247 Y:22525571-22525593 ACTCAAGCATCTTCTAGGGGAGG No data
1202219243_1202219245 11 Left 1202219243 Y:22525533-22525555 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202219245 Y:22525567-22525589 GAATACTCAAGCATCTTCTAGGG No data
1202219243_1202219244 10 Left 1202219243 Y:22525533-22525555 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202219244 Y:22525566-22525588 TGAATACTCAAGCATCTTCTAGG No data
1202219243_1202219246 12 Left 1202219243 Y:22525533-22525555 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202219246 Y:22525568-22525590 AATACTCAAGCATCTTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202219243 Original CRISPR CACCTAGAATTATCTAGCCC TGG (reversed) Intergenic
No off target data available for this crispr