ID: 1202219245

View in Genome Browser
Species Human (GRCh38)
Location Y:22525567-22525589
Sequence GAATACTCAAGCATCTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202219243_1202219245 11 Left 1202219243 Y:22525533-22525555 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202219245 Y:22525567-22525589 GAATACTCAAGCATCTTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202219245 Original CRISPR GAATACTCAAGCATCTTCTA GGG Intergenic
No off target data available for this crispr