ID: 1202219247

View in Genome Browser
Species Human (GRCh38)
Location Y:22525571-22525593
Sequence ACTCAAGCATCTTCTAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202219243_1202219247 15 Left 1202219243 Y:22525533-22525555 CCAGGGCTAGATAATTCTAGGTG No data
Right 1202219247 Y:22525571-22525593 ACTCAAGCATCTTCTAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202219247 Original CRISPR ACTCAAGCATCTTCTAGGGG AGG Intergenic
No off target data available for this crispr