ID: 1202221101

View in Genome Browser
Species Human (GRCh38)
Location Y:22550348-22550370
Sequence TCTGAAAGGCAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202221101_1202221106 11 Left 1202221101 Y:22550348-22550370 CCTTCCTCTTTCTGCCTTTCAGA No data
Right 1202221106 Y:22550382-22550404 TTTTTTTCTCGTTATATCCATGG No data
1202221101_1202221109 30 Left 1202221101 Y:22550348-22550370 CCTTCCTCTTTCTGCCTTTCAGA No data
Right 1202221109 Y:22550401-22550423 ATGGTGTTTTAGTTGTTTGGAGG No data
1202221101_1202221107 27 Left 1202221101 Y:22550348-22550370 CCTTCCTCTTTCTGCCTTTCAGA No data
Right 1202221107 Y:22550398-22550420 TCCATGGTGTTTTAGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202221101 Original CRISPR TCTGAAAGGCAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr