ID: 1202222576

View in Genome Browser
Species Human (GRCh38)
Location Y:22567185-22567207
Sequence AAGGTCTCATCCTCCCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202222576_1202222581 -7 Left 1202222576 Y:22567185-22567207 CCCCAATGGGAGGATGAGACCTT No data
Right 1202222581 Y:22567201-22567223 AGACCTTGGTTTGGTGTAGCAGG No data
1202222576_1202222584 27 Left 1202222576 Y:22567185-22567207 CCCCAATGGGAGGATGAGACCTT No data
Right 1202222584 Y:22567235-22567257 TGACCCATGAATTTTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202222576 Original CRISPR AAGGTCTCATCCTCCCATTG GGG (reversed) Intergenic
No off target data available for this crispr