ID: 1202222577

View in Genome Browser
Species Human (GRCh38)
Location Y:22567186-22567208
Sequence CAAGGTCTCATCCTCCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202222577_1202222581 -8 Left 1202222577 Y:22567186-22567208 CCCAATGGGAGGATGAGACCTTG No data
Right 1202222581 Y:22567201-22567223 AGACCTTGGTTTGGTGTAGCAGG No data
1202222577_1202222584 26 Left 1202222577 Y:22567186-22567208 CCCAATGGGAGGATGAGACCTTG No data
Right 1202222584 Y:22567235-22567257 TGACCCATGAATTTTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202222577 Original CRISPR CAAGGTCTCATCCTCCCATT GGG (reversed) Intergenic
No off target data available for this crispr