ID: 1202222581

View in Genome Browser
Species Human (GRCh38)
Location Y:22567201-22567223
Sequence AGACCTTGGTTTGGTGTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202222578_1202222581 -9 Left 1202222578 Y:22567187-22567209 CCAATGGGAGGATGAGACCTTGG No data
Right 1202222581 Y:22567201-22567223 AGACCTTGGTTTGGTGTAGCAGG No data
1202222576_1202222581 -7 Left 1202222576 Y:22567185-22567207 CCCCAATGGGAGGATGAGACCTT No data
Right 1202222581 Y:22567201-22567223 AGACCTTGGTTTGGTGTAGCAGG No data
1202222577_1202222581 -8 Left 1202222577 Y:22567186-22567208 CCCAATGGGAGGATGAGACCTTG No data
Right 1202222581 Y:22567201-22567223 AGACCTTGGTTTGGTGTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202222581 Original CRISPR AGACCTTGGTTTGGTGTAGC AGG Intergenic
No off target data available for this crispr