ID: 1202222582

View in Genome Browser
Species Human (GRCh38)
Location Y:22567204-22567226
Sequence AAACCTGCTACACCAAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202222582_1202222588 19 Left 1202222582 Y:22567204-22567226 CCTTGGTTTGGTGTAGCAGGTTT No data
Right 1202222588 Y:22567246-22567268 TTTTAAAAGAGGTCTCAGGTAGG No data
1202222582_1202222589 26 Left 1202222582 Y:22567204-22567226 CCTTGGTTTGGTGTAGCAGGTTT No data
Right 1202222589 Y:22567253-22567275 AGAGGTCTCAGGTAGGAATTTGG No data
1202222582_1202222584 8 Left 1202222582 Y:22567204-22567226 CCTTGGTTTGGTGTAGCAGGTTT No data
Right 1202222584 Y:22567235-22567257 TGACCCATGAATTTTAAAAGAGG No data
1202222582_1202222590 27 Left 1202222582 Y:22567204-22567226 CCTTGGTTTGGTGTAGCAGGTTT No data
Right 1202222590 Y:22567254-22567276 GAGGTCTCAGGTAGGAATTTGGG No data
1202222582_1202222591 28 Left 1202222582 Y:22567204-22567226 CCTTGGTTTGGTGTAGCAGGTTT No data
Right 1202222591 Y:22567255-22567277 AGGTCTCAGGTAGGAATTTGGGG No data
1202222582_1202222587 15 Left 1202222582 Y:22567204-22567226 CCTTGGTTTGGTGTAGCAGGTTT No data
Right 1202222587 Y:22567242-22567264 TGAATTTTAAAAGAGGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202222582 Original CRISPR AAACCTGCTACACCAAACCA AGG (reversed) Intergenic
No off target data available for this crispr