ID: 1202222839

View in Genome Browser
Species Human (GRCh38)
Location Y:22569278-22569300
Sequence CTGTTTCCACAGAGTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202222837_1202222839 27 Left 1202222837 Y:22569228-22569250 CCAGAGGGGTTGCTCTATAAGGT No data
Right 1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG No data
1202222835_1202222839 28 Left 1202222835 Y:22569227-22569249 CCCAGAGGGGTTGCTCTATAAGG No data
Right 1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202222839 Original CRISPR CTGTTTCCACAGAGTCATGA AGG Intergenic
No off target data available for this crispr