ID: 1202227810

View in Genome Browser
Species Human (GRCh38)
Location Y:22624823-22624845
Sequence CTGAGCTGCAGTTGTGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202227809_1202227810 3 Left 1202227809 Y:22624797-22624819 CCACAAAATGACAGCAGCATGCT No data
Right 1202227810 Y:22624823-22624845 CTGAGCTGCAGTTGTGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202227810 Original CRISPR CTGAGCTGCAGTTGTGCATA TGG Intergenic
No off target data available for this crispr