ID: 1202230758

View in Genome Browser
Species Human (GRCh38)
Location Y:22655132-22655154
Sequence GGGAATTATCTAGCAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202230758_1202230764 21 Left 1202230758 Y:22655132-22655154 CCTGTGTTTGCTAGATAATTCCC No data
Right 1202230764 Y:22655176-22655198 TAGCAGTATTCTTTGATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202230758 Original CRISPR GGGAATTATCTAGCAAACAC AGG (reversed) Intergenic
No off target data available for this crispr