ID: 1202233602 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:22682863-22682885 |
Sequence | GAGGTAATATACATAGAACA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202233602_1202233606 | 6 | Left | 1202233602 | Y:22682863-22682885 | CCTTGTTCTATGTATATTACCTC | No data | ||
Right | 1202233606 | Y:22682892-22682914 | TAATTGGAATACACCCCATCAGG | No data | ||||
1202233602_1202233604 | -10 | Left | 1202233602 | Y:22682863-22682885 | CCTTGTTCTATGTATATTACCTC | No data | ||
Right | 1202233604 | Y:22682876-22682898 | ATATTACCTCTGGTTGTAATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202233602 | Original CRISPR | GAGGTAATATACATAGAACA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |