ID: 1202233602

View in Genome Browser
Species Human (GRCh38)
Location Y:22682863-22682885
Sequence GAGGTAATATACATAGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202233602_1202233606 6 Left 1202233602 Y:22682863-22682885 CCTTGTTCTATGTATATTACCTC No data
Right 1202233606 Y:22682892-22682914 TAATTGGAATACACCCCATCAGG No data
1202233602_1202233604 -10 Left 1202233602 Y:22682863-22682885 CCTTGTTCTATGTATATTACCTC No data
Right 1202233604 Y:22682876-22682898 ATATTACCTCTGGTTGTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202233602 Original CRISPR GAGGTAATATACATAGAACA AGG (reversed) Intergenic
No off target data available for this crispr