ID: 1202237384

View in Genome Browser
Species Human (GRCh38)
Location Y:22727246-22727268
Sequence ATTCAGATTAGTATCTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202237382_1202237384 19 Left 1202237382 Y:22727204-22727226 CCACCTTAAATTTTTATGTTTAG No data
Right 1202237384 Y:22727246-22727268 ATTCAGATTAGTATCTATGTAGG No data
1202237383_1202237384 16 Left 1202237383 Y:22727207-22727229 CCTTAAATTTTTATGTTTAGAAT No data
Right 1202237384 Y:22727246-22727268 ATTCAGATTAGTATCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202237384 Original CRISPR ATTCAGATTAGTATCTATGT AGG Intergenic
No off target data available for this crispr