ID: 1202237472

View in Genome Browser
Species Human (GRCh38)
Location Y:22728550-22728572
Sequence TCCCTGCGTTGAGGGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202237472_1202237475 8 Left 1202237472 Y:22728550-22728572 CCAGCACACCCTCAACGCAGGGA No data
Right 1202237475 Y:22728581-22728603 ACAAATTTTCCTTTGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202237472 Original CRISPR TCCCTGCGTTGAGGGTGTGC TGG (reversed) Intergenic
No off target data available for this crispr