ID: 1202245871

View in Genome Browser
Species Human (GRCh38)
Location Y:22819440-22819462
Sequence TCACCAAGCCTGCTATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202245871_1202245874 2 Left 1202245871 Y:22819440-22819462 CCTGTCTATAGCAGGCTTGGTGA No data
Right 1202245874 Y:22819465-22819487 TACTATTTCAGGGTGTATCCAGG No data
1202245871_1202245876 23 Left 1202245871 Y:22819440-22819462 CCTGTCTATAGCAGGCTTGGTGA No data
Right 1202245876 Y:22819486-22819508 GGTTGTGTGATTTTCCAAATAGG No data
1202245871_1202245873 -8 Left 1202245871 Y:22819440-22819462 CCTGTCTATAGCAGGCTTGGTGA No data
Right 1202245873 Y:22819455-22819477 CTTGGTGACATACTATTTCAGGG No data
1202245871_1202245872 -9 Left 1202245871 Y:22819440-22819462 CCTGTCTATAGCAGGCTTGGTGA No data
Right 1202245872 Y:22819454-22819476 GCTTGGTGACATACTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202245871 Original CRISPR TCACCAAGCCTGCTATAGAC AGG (reversed) Intergenic
No off target data available for this crispr