ID: 1202247620

View in Genome Browser
Species Human (GRCh38)
Location Y:22835919-22835941
Sequence TCCAGGGCCATTCCTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202247617_1202247620 5 Left 1202247617 Y:22835891-22835913 CCAGGCACATCACTGATGATACT No data
Right 1202247620 Y:22835919-22835941 TCCAGGGCCATTCCTCAAAGAGG No data
1202247616_1202247620 11 Left 1202247616 Y:22835885-22835907 CCTAGGCCAGGCACATCACTGAT No data
Right 1202247620 Y:22835919-22835941 TCCAGGGCCATTCCTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202247620 Original CRISPR TCCAGGGCCATTCCTCAAAG AGG Intergenic
No off target data available for this crispr