ID: 1202251526

View in Genome Browser
Species Human (GRCh38)
Location Y:22878327-22878349
Sequence GGAGGCCACACGGAGCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202251526_1202251533 -1 Left 1202251526 Y:22878327-22878349 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202251533 Y:22878349-22878371 CATGTACACAGGGCCCAAGGAGG No data
1202251526_1202251531 -4 Left 1202251526 Y:22878327-22878349 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202251531 Y:22878346-22878368 CTCCATGTACACAGGGCCCAAGG No data
1202251526_1202251534 0 Left 1202251526 Y:22878327-22878349 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202251534 Y:22878350-22878372 ATGTACACAGGGCCCAAGGAGGG No data
1202251526_1202251537 23 Left 1202251526 Y:22878327-22878349 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202251537 Y:22878373-22878395 AGTCACTTCACCTAGATGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202251526 Original CRISPR GGAGGCCACACGGAGCATTG TGG (reversed) Intergenic
No off target data available for this crispr