ID: 1202251531

View in Genome Browser
Species Human (GRCh38)
Location Y:22878346-22878368
Sequence CTCCATGTACACAGGGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202251526_1202251531 -4 Left 1202251526 Y:22878327-22878349 CCACAATGCTCCGTGTGGCCTCC No data
Right 1202251531 Y:22878346-22878368 CTCCATGTACACAGGGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202251531 Original CRISPR CTCCATGTACACAGGGCCCA AGG Intergenic
No off target data available for this crispr