ID: 1202251722

View in Genome Browser
Species Human (GRCh38)
Location Y:22880035-22880057
Sequence CTAATAATGACAATTGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202251722_1202251727 -3 Left 1202251722 Y:22880035-22880057 CCAGGTACAATTGTCATTATTAG No data
Right 1202251727 Y:22880055-22880077 TAGGGTTTCGGTCTGGTCTCAGG No data
1202251722_1202251730 25 Left 1202251722 Y:22880035-22880057 CCAGGTACAATTGTCATTATTAG No data
Right 1202251730 Y:22880083-22880105 GGAACAGTATCACCTCTGGCAGG No data
1202251722_1202251728 4 Left 1202251722 Y:22880035-22880057 CCAGGTACAATTGTCATTATTAG No data
Right 1202251728 Y:22880062-22880084 TCGGTCTGGTCTCAGGTATATGG No data
1202251722_1202251731 26 Left 1202251722 Y:22880035-22880057 CCAGGTACAATTGTCATTATTAG No data
Right 1202251731 Y:22880084-22880106 GAACAGTATCACCTCTGGCAGGG No data
1202251722_1202251729 21 Left 1202251722 Y:22880035-22880057 CCAGGTACAATTGTCATTATTAG No data
Right 1202251729 Y:22880079-22880101 ATATGGAACAGTATCACCTCTGG No data
1202251722_1202251726 -10 Left 1202251722 Y:22880035-22880057 CCAGGTACAATTGTCATTATTAG No data
Right 1202251726 Y:22880048-22880070 TCATTATTAGGGTTTCGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202251722 Original CRISPR CTAATAATGACAATTGTACC TGG (reversed) Intergenic
No off target data available for this crispr