ID: 1202252213

View in Genome Browser
Species Human (GRCh38)
Location Y:22885015-22885037
Sequence GAGTCACTTCACCTGGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202252211_1202252213 -6 Left 1202252211 Y:22884998-22885020 CCAGGACTCTGGAAGAAGAGTCA No data
Right 1202252213 Y:22885015-22885037 GAGTCACTTCACCTGGCTACTGG No data
1202252208_1202252213 23 Left 1202252208 Y:22884969-22884991 CCAGTGAGATGTCACAATCTTTC No data
Right 1202252213 Y:22885015-22885037 GAGTCACTTCACCTGGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202252213 Original CRISPR GAGTCACTTCACCTGGCTAC TGG Intergenic
No off target data available for this crispr