ID: 1202252213 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:22885015-22885037 |
Sequence | GAGTCACTTCACCTGGCTAC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1202252211_1202252213 | -6 | Left | 1202252211 | Y:22884998-22885020 | CCAGGACTCTGGAAGAAGAGTCA | No data | ||
Right | 1202252213 | Y:22885015-22885037 | GAGTCACTTCACCTGGCTACTGG | No data | ||||
1202252208_1202252213 | 23 | Left | 1202252208 | Y:22884969-22884991 | CCAGTGAGATGTCACAATCTTTC | No data | ||
Right | 1202252213 | Y:22885015-22885037 | GAGTCACTTCACCTGGCTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1202252213 | Original CRISPR | GAGTCACTTCACCTGGCTAC TGG | Intergenic | ||
No off target data available for this crispr |