ID: 1202253060

View in Genome Browser
Species Human (GRCh38)
Location Y:22892948-22892970
Sequence CTGTGTGAGTCCAAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1202253056_1202253060 18 Left 1202253056 Y:22892907-22892929 CCAGGACTTTACCCATGGCTCTG No data
Right 1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG No data
1202253058_1202253060 6 Left 1202253058 Y:22892919-22892941 CCATGGCTCTGAGAGTCAAAATA No data
Right 1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG No data
1202253057_1202253060 7 Left 1202253057 Y:22892918-22892940 CCCATGGCTCTGAGAGTCAAAAT No data
Right 1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1202253060 Original CRISPR CTGTGTGAGTCCAAGTATGA GGG Intergenic
No off target data available for this crispr